uj herb
Wydział Biologii 
Instytut Zoologii i Badań Biomedycznych 

Rola wybranych białek mitochondrialnych w chorobie Parkinsona 

-badania na modelu Drosophila melanogaster 
Bartosz Doktór 
Rozprawa doktorska wykonana pod opieką prof. dr hab. Elżbiety Pyzy w Zakładzie Biologii i Obrazowania Komórki Instytutu Zoologii i Badań Biomedycznych 

Kraków 2019 

Pani prof. Elżbiecie Pyzie dziękuję za opiekę naukową, cenne rady 
oraz wsparcie merytoryczne. 
Pani dr Milenie Damulewicz dziękuję za pomoc naukową oraz cenne rady. 
Pracownikom i doktorantom 
Zakładu Biologii i Obrazowania Komórki dziękuję za wszelką pomoc. 
Swoim rodzicom, dziadkom oraz narzeczonej 
dziękuję za wsparcie podczas studiów doktoranckich. 


Spis treści 
Wykaz stosowanych skrótów ..................................................................................................... 3 <BR><BR>Streszczenie................................................................................................................................ 5 <BR><BR>Summary .................................................................................................................................... 6 <BR><BR>Wykaz publikacji naukowych oraz oświadczeń współautorów................................................. 7 <BR><BR>Wprowadzenie.......................................................................................................................... 15 <BR><BR>Choroba Parkinsona ............................................................................................................. 15 <BR><BR>Modele choroby Parkinsona.................................................................................................16 <BR><BR>Zegar okołodobowy.............................................................................................................. 19 <BR><BR>Plastyczność synaptyczna .................................................................................................... 21 <BR><BR>Cel pracy .................................................................................................................................. 23 <BR><BR>Dyskusja ................................................................................................................................... 24 <BR><BR>Wnioski .................................................................................................................................... 31 <BR><BR>Piśmiennictwo .......................................................................................................................... 32 <BR><BR>

Wykaz stosowanych skrótów 
ATG (ang. Autophagy-Related) – białka odpowiedzialne za proces autofagii BRP (ang. Bruchpilot) – presynaptyczne białko budujące strefy aktywne u D. melanogaster CCG (ang. Clock–Controlled Gens) – geny, których ekspresja jest regulowana przez zegar okołodobowy CK2 (ang. Casein Kinase 2) – kinaza regulująca pracę zegara okołodobowego 
Clk (ang. Clock) -gen zegara okołodobowego Cry (ang. Cryptochrome) -gen zegara okołodobowego DBT (ang. Double-Time) – kinaza zegara okołodobowego Dcp-1 (ang. Death Caspase-1) – białko odpowiedzialne za apoptozę u D. melanogaster 
Dlg1 (ang. Discs Large 1) – białko u D. melanogaster odpowiedzialne za transmisję synaptyczną 
DN (ang. Dorsal Neurons) – neurony grzbietowe DRP1 (ang. Dynamin-Related Protein 1) – białko wewnętrznej błony mitochondrialnej, niezbędne do procesu rozszczepienia mitochondriów 
eIF2α (ang. Eukaryotic Initiation Factor 2) -czynnik translacyjny 
Elav – marker komórek nerwowych LB (ang. Lewy Bodies) – ciałka Lewyego, złogi ubikwityny, α-synukleiny i innych białek LC3 (ang. Light Chain) – białko budujące autofagosom 

l-LNvs (ang. Large Ventral Lateral Neurons) -neurony boczne brzuszne o dużym ciele komórkowym 
LNd (ang. Lateral Dorsal Neurons) -neurony boczne grzbietowe LPN (ang. Lateral Posterior Neurons) – neurony boczne tylne LRRK2 (ang. Leucine-Rich Repeat Kinase 2) – kinaza mitochondrialna i cytoplazmatyczna LTD (ang. Long-term Depression) – długotrwałe wyciszenie synaptyczne 

LTP (ang. Long-term Potentiation) – długotrwałe wzmocnienie synaptyczne 
Mfn (ang. Mitofusin) – białko zewnętrznej błony mitochondrialnej, odpowiedzialne za fuzję mitochondriów 
MOA (ang. Monoamine Oxidase) – oksydaza monoaminowa, enzym MPP (ang. Mitochondrial Processing Peptidase) – mitochondrialna peptydaza 

MTS (ang. Mitochondrial Targeting Sequence) -domena kierująca białko PINK1 do mitochondriów MUL1 (ang. Mitochondrial Ubiquitin Ligase 1) – ligaza mitochondrialna uczestnicząca w mitofagii p62 – białko wyznaczające substraty do degradacji 
PARKIN – parkina, ligaza mitochondrialna uczestnicząca w mitofagii PARL (ang. Presenilin-Associated Rhomboid-Like) – mitochondrialna wewnątrzbłonowa 
proteaza 
PD (ang. Parkinson’s Disease) – choroba Parkinsona PDF (ang. Pigment Dispersing Factor) -czynnik rozpraszający pigment, neuropeptyd zegara 
Pdp (ang. PAR Domain Protein) -gen zegara okołodobowego Per (ang. Period) -gen zegara okołodobowego PINK1 (ang. PTEN-Induced Putative Kinase 1) – kinaza mitochondrialna uczestnicząca w mitofagii REM (ang. Rapid Eye Movement) – sen paradoksalny, faza snu, w której występują szybkie 
ruchy gałek ocznych 
ROS (ang. Reactive Oxygen Species) -wolne rodniki tlenowe sLNvs (ang. Small Ventral Lateral Neurons) -neurony boczne brzuszne o małym ciele komórkowym SNCA (ang. Synuclein Alpha) – gen kodujący białko α-synukleinę SOD1/2 (ang. Superoxide Dismutase 1/2) – dysmutaza ponadtlenkowa, białko o funkcji 
antyoksydacyjnej 

SUMO (ang. Small Ubiquitin-Like Modifier) – białko podobne do ubikwityny, dołączane 
w procesie SUMOilacji 
Tim (ang. Timeless) -gen zegara okołodobowego TMS (ang. Transmembrane Sequence) – domena kierująca białko PINK1 do mitochondrialnej przestrzeni międzybłonowej VPS35 (ang. Vacuolar Protein Sorting 35) -białko transportujące białka z endosomów Vri (ang. Vrille) -gen zegara okołodobowego 

Streszczenie 
Choroba Parkinsona jest jedną z najczęściej występujących chorób neurodegeneracyjnych. Do najbardziej charakterystycznych objawów tej choroby zaliczane są: degeneracja neuronów dopaminergicznych, zmniejszenie poziomu dopaminy, wzrost poziomu wolnych rodników, a także problemy ze snem oraz poruszaniem się. Do modelowania symptomów choroby Parkinsona najczęściej wykorzystywane są neurotoksyny hamujące aktywność pierwszego kompleksu mitochondrialnego bądź mutacje genów kodujących białka biorące udział w mitofagii. 
W pierwszej części pracy zbadano związek pomiędzy chorobą Parkinsona wywołaną mutacjami genów mul1 oraz park a zaburzeniami pracy zegara okołodobowego u Drosophila melanogaster. Przeprowadzono analizę ekspresji głównych genów zegara (per, tim, clk) oraz białka (PER) w mózgu, a także analizę okołodobowej aktywności lokomotorycznej. Otrzymane wyniki wykazały, że umutantów mul1 oraz park faza rytmu ekspresji genów zegara jest przesunięta, natomiast rytm ekspresji białka PER jest całkowicie zniesiony, co skutkuje zaburzonym rytmem aktywności lokomotorycznej. Wykazano, że zmiana ta jest następstwem zahamowania autofagii u tych mutantów, a także zwiększonej liczby wolnych rodników w mózgu oraz zmniejszeniem poziomu SOD1. 
W kolejnej części wykazano, że nadekspresja genów kodujących białka MUL1 oraz PARK w neuronach hamuje rozwój choroby Parkinsona wywołanej rotenonem. Wykonano analizę liczby neuronów dopaminergicznych, wyznakowanych immunohistochemicznie, zbadano poziom białek synaptycznych biorących udział w egzocytozie neuroprzekaźników (analiza Western Blot), zanalizowano błonę presynaptyczną w celu zbadania morfologii stref aktywnych synaps (elektronowy mikroskop transmisyjny), a także zbadano aktywność lokomotoryczną. Uzyskane wyniki wykazały, że szczepy z nadekspresją mul1 i park nie wykazują degeneracji neuronów dopaminergicznych po podaniu rotenonu, poziom badanych białek synaptycznych nie ulega zmniejszeniu, a strefy aktywne w elementach presynaptycznych nie posiadają żadnych nieprawidłowości. Ponadto aktywność motoryczna badanych osobników ulega poprawie. Wykazano, że obserwowane efekty są związane z obniżeniem poziomu apoptozy oraz zwiększeniem poziomu autofagii i poziomu białka SOD1. Stwierdzono również, że mutacja genu kodującego kinazę mitochondrialną PINK1 
powoduje zaburzenia w morfologii i funkcjonowaniu synaps, podobne do obserwowanych na 
modelach wywołanych rotenonem. 

Summary 
Parkinson's disease is one of the most common neurodegenerative diseases worldwide. The most characteristic symptoms of this disease include loss of dopaminergic neurons, reduction of dopamine levels, increase of free radicals level, and problems with sleep and movement. Neurotoxins, which inhibit activity of the first mitochondrial complex or mutations of genes encoding proteins involved in mitophagy, are the most frequently used to model symptoms of Parkinson’s disease. 
In the first part of this work, we examined the link between the Parkinson's disease caused by mutations of mul1 and park genes and circadian rhythmic disorder in Drosophila melanogaster. The circadian rhythm of locomotor activity depends on the cyclic expression of the main clock genes (per, tim) and protein (PER) in the brain. Flies with mu1l or park mutations showed half an hour phase shift of clock gene expression while the rhythm of PER protein expression was completely abolished. This resulted in disruption of locomotor activity rhythm. Our results suggest that observed changes are a consequence of the suppression of autophagy, as well as an increased number of free radicals in the brain and reduction of SOD1 level. 
We also showed that overexpression of genes encoding MUL1 and PARK proteins in neurons suppresses development of rotenone-induced Parkinson's disease. The number of dopaminergic neurons was evaluated using immunohistochemistry. Western Blot analysis was used to investigate the level of synaptic proteins involved in neurotransmitter exocytosis. Using a transmission electron microscope, the presynaptic membrane was visualized and examined. The negative geotaxis test was carried out to evaluate motor activity. The conducted studies showed that mul1 or park overexpressing strains do not show dopaminergic neuron degeneration after administration of rotenone, the level of synaptic proteins was not reduced, active zones in the presynaptic elements did not have any abnormalities and motor activity of flies was improved. Our results suggest that these effects may result from decreased level of apoptosis and increased autophagy and SOD1 protein level. We also found that mutation of the gene encoding the mitochondrial kinase PINK1 also causes synaptic and motor disorders similar to those observed in the previously described rotenone-induced models. 


Wykaz publikacji naukowych oraz oświadczeń współautorów 
1. 	Doktór B., Damulewicz M., Krzeptowski W., Bednarczyk B., Pyza E. (2018). Effects of PINK1 mutation on synapses and behavior in the brain of Drosophila melanogaster. Acta Neurobiol. Exp. (Wars). 78, 231–241. 
IF : 1.286        MNiSW : 20        Pierwszy autor 




2. 	
Doktór B., Damulewicz M., Pyza E. (2019). Effects of MUL1 and PARKIN on the circadian clock, brain and behaviour in Drosophila Parkinson’s disease models. 

3. 	
Doktór B., Damulewicz M., Pyza E. (2019). Overexpression of mitochondrial ligases reverses rotenone-induced effects in a Drosophila model of Parkinson’s disease. Frontiers in Neuroscience, 13(FEB), 1–10. 


BMC Neuroscience, 20(1), 24. 

IF : 2.665        MNiSW : 25 Pierwszy autor 


IF : 3.656        MNiSW : -Pierwszy autor 


Wprowadzenie 
Choroba Parkinsona 

Choroba Parkinsona (ang. Parkinon’s disease, PD) jest jedną z najczęściej występujących chorób neurodegeneracyjnych. Częstotliwość występowania PD wynosi około 1% u osób w wieku około 60 lat i starszych a wzrasta do 3% u osób powyżej 60 roku życia (Driver i wsp., 2009). PD po raz pierwszy została opisana przez dr. Jamesa Parkinsona w 1817 roku jako „shaking palsy” (Parkinson, 2002). Jest to chroniczna, progresywna choroba neurodegeneracyjna, charakteryzowana przez objawy motoryczne i niemotoryczne. Objawy motoryczne są konsekwencją degeneracji neuronów dopaminergicznych, natomiast obecność objawów niemotorycznych wiąże się z utratą neuronów z obszarów innych niż SN. Określenie „parkinsonizm” jest kompleksem opisującym objawy motoryczne PD, do których zalicza się drżenie spoczynkowe, spowolnienie ruchu i sztywność mięśni (Twelves i wsp., 2003). Badania pokazują, że zmiany patofizjologiczne w mózgu związane z chorobą Parkinsona mogą pojawiać się przed wystąpieniem objawów motorycznych 
obejmują szereg niemotorycznych cech, takich jak zaburzenia snu, depresja, zmiany poznawcze (Schrag i wsp., 2015). 
Postępująca utrata neuronów dopaminergicznych w istocie czarnej pars compacta (SNpc), której projekcje sięgają do prążkowia (szlak nigrostriatalny), powoduje utratę funkcji układu dopaminergicznego u osób z PD. Objawy motoryczne pojawią się u osób chorych po utracie od 50% do 80% neuronów dopaminergicznych (DeMaagd i Philip, 2015). Drugą, ważną cechą histopatologiczną PD jest obecność ciałek Lewyego (ang. Lewy Bodies, LB), opisywanych jako wewnątrzkomórkowe agregaty cytoplazmatyczne złożone z białek, lipidów oraz innych komponentów (Del Tredici i Braak, 2012). Tworzenie LB wiąże się z nadmiernym wytwarzaniem nieprawidłowo sfałdowanych białek ubikwityny, które biorą udział w recyklingu innych białek. Ich zwiększona ekspresja może być przyczyną zahamowania procesów rozkładających nieprawidłowe białka. Stwierdzono, że mutacje w obrębie genu kodującego białko α-synukleiny (SNCA, z ang. Synuclein Alpha) powodują tworzenie się i agregację nierozpuszczalnych włókien tego białka, które są związane z LB (Del Tredici i Braak, 2012; Yasuda i Mochizuki, 2010). W rozwoju choroby Parkinsona istotnym elementem jest również obszerne zapalenie i udział cytokin prozapalnych. Reakcje zapalne pojawiające się podczas degeneracji neuronów dopaminergicznych przyczyniają się do patogenezy choroby. Badania potwierdzają również aktywację mikrogleju i astrocytów w uszkodzonych komórkach dopaminowych (Kim i Joh, 2006; Whitton, 2009). 
Z rozwojem choroby Parkinsona związane są liczne czynniki ryzyka oraz mutacje genetyczne. Do czynników ryzyka zalicza się stres oksydacyjny bądź wpływ toksyn środowiskowych (np. pestycydy, herbicydy) (Logroscino, 2005; Zhou i wsp., 2008). Badania wykazały również szereg genów wspomagających zapoczątkowanie choroby. Do najważniejszych genów, których mutacje związane są z rozwojem PD zaliczane są: SNCA, LRRK2 (z ang. Leucine-rich repeat kinase 2), PINK1 (z ang. PTEN-induced putative kinase 1), parkin, SOD2 (z ang. Superoxide dismutase 2), VPS35 (z ang. Vacuolar protein sorting 35) (Singleton i wsp., 2013; Spatola i Wider, 2014). Do czynników środowiskowych zmniejszających ryzyko rozwoju PD zaliczyć można palenie papierosów i spożywanie kofeiny. Palenie tytoniu hamuje działanie enzymu monoaminooksydazy – MAO (z ang. Monoamine Oxidase) rozkładającej między innymi dopaminę, natomiast korzyści z kofeiny są związane z aktywnością antagonistyczną wobec adenozyny (Liu i wsp., 2012). Blokowanie receptorów adenozyny wpływa na zwiększenie uwalniania neuroprzekaźników takich jak acetylocholina czy dopamina. 
Leki dopaminergiczne są podstawą objawowej terapii stosowanej w PD. Odkryta w 1960 roku lewodopa była pierwszym lekiem objawowym w chorobie Parkinsona. Z czasem zaczęto stosować agonistów receptorów dopaminowych czy inhibitorów monoaminooksydazy B. Nie ma obecnie jednego leku zalecanego do rozpoczęcia kuracji, ale należy wziąć pod uwagę takie czynniki jak nasilenie objawów, bądź koszt kuracji i preferencje pacjenta. Aktualnie do najczęściej stosowanych leków zalicza się: lewodopę (zwiększającą metabolizm dopaminy), agonistów dopaminergicznych (np. Ropinirol), inhibitory katechol-O-metylotransferzay (np. Entacapone), blokery receptorów NMDA 
cholinergicznych (Amantadyna) czy leki antycholinergiczne (Triheksyfenidyl) (Rizek i wsp., 2016). Należy również podkreślić, że jest to choroba jak dotąd nieuleczalna, a wszystkie leki stosowane w terapii mają za zadanie tylko spowolnić jej rozwój. 
Modele choroby Parkinsona 

Dokładne prześledzenie patogenezy choroby Parkinsona oraz tworzenie nowych opcji terapeutycznych możliwe jest przede wszystkim dzięki zwierzęcym modelom tej choroby. Najczęściej stosowanymi organizmami modelowymi są szczury oraz myszy, u których wywołuje się objawy chorobowe używając manipulacji genetycznych bądź odpowiednich neurotoksyn. Do grupy zwierząt modelowych zalicza się także muszkę owocową 
D. melanogaster. W 2000 roku naukowcy opracowali pierwszy transgeniczny szczep muszki owocowej prezentujący typowe objawy PD. Wprowadzili oni zmutowaną formę genu SNCA, co skutkowało degeneracją neuronów dopaminergicznych oraz defektami behawioralnymi (brak zdolności do wspinaczki) (Feany i Bender, 2000). Parę lat później udowodniono również, że stosując selektywne neurotoksyny można modelować objawy PD u muszki owocowej. W 2004 roku innej grupie naukowców udało się uzyskać podobny fenotyp używając neurotoksyny rotenonu. Po siedmiodniowej ekspozycji na 500 µM rotenonu, osobniki badane prezentowały utratę neuronów dopaminergicznych, a także osłabione czynności motoryczne (Coulom i Birman, 2004). W niniejszej pracy wykorzystane zostały cztery modele choroby Parkinsona muszki owocowej: trzy genetyczne (mutacje genów pink1, parkin oraz mul1), oraz jeden z wykorzystaniem neurotoksyny (rotenon). 
PINK1 (z ang. PTEN-Induced Putative Kinase 1) jest mitochondrialną kinazą serynowo/treoninową, związaną z autosomalną recesywną chorobą Parkinsona. W komórkach białko to gromadzi się na powierzchni uszkodzonych mitochondriów, gdzie wraz z ligazą PARKIN, inicjuje proces mitofagii (Matsuda i wsp., 2010). PINK1 zawiera N-końcową sekwencję MTS (z ang. Mitochondrial Targeting Sequence), TMS (z ang. Transmembrane Sequence) oraz domenę kinazy Ser/Thr zlokalizowaną na C-końcu (Eiyama i Okamoto, 2015). W fizjologicznych warunkach PINK1 ulega translokacji do błony mitochondrialnej, gdzie jego domena MTS jest odcinana przez mitochondrialną peptydazę – MPP (z ang. Mitochondrial Processing Peptidase) (Greene i wsp., 2012), a TMS przez białko PARL (z ang. Presenilin-Associated Rhomboid-Like) (Deas i wsp., 2011). PINK1 bez domen TMS i MTS przenoszony jest do cytoplazmy, gdzie ulega degradacji w proteasomach (Yamano i Youle, 2013). Uszkodzone mitochondria nie utrzymują potencjału na wewnętrznej błonie i w efekcie domeny MTS i TMS nie mogą zostać usunięte, a PINK1 stabilizowane jest na zewnętrznej błonie mitochondrialnej (Chen i Dorn, 2013). W kolejnym etapie PINK1 wraz z PARKIN kierują mitofuzyny oraz poryny obecne na zewnętrznej błonie mitochondrialnej na drogę proteasomalnej degradacji, prowadząc tym samym do degradacji całego organellium (Thomas i wsp., 2014). W wyniku mutacji genu pink1, uszkodzone i stare mitochondria, które są źródłem dużej ilości wolnych rodników, nie mogą ulec degradacji, a zatem powodują dysfunkcję bądź śmierć neuronów, co prowadzi do powstania objawów PD. U muszki owocowej mutacja ta powoduje zmianę morfologii mitochondriów, zmniejszenie poziomu ATP, skrócenie długości życia oraz redukcję aktywności motorycznej (Clark i wsp., 2006; Park i wsp., 2006b). 
Drugim z genów, którego mutacja prowadzi do powstania objawów PD jest gen kodujący białko PARKIN. Jest on, podobnie jak PINK1, związany z autosomalną recesywną chorobą Parkinsona (Kitada i wsp., 1998). PARKIN jest ligazą ubikwityny E3 znajdującą się w obrębie cytoplazmy. Enzymy E3, we współpracy z enzymami klasy E1 oraz E2, pośredniczą w kowalencyjnym wiązaniu ubikwityny z białkami substratowymi (Ciechanover, 2005; Winklhofer, 2014). PARKIN posiada N-końcową domenę podobną do ubikwityny (Ubl) oraz cztery domeny palca cynkowego (RING), z których trzy tworzą motyw RING1-In Between-RING2 (RBR) (Trempe i Fon, 2013). Tym samym białko to należy do rodziny ligaz E3 RBR, które w odróżnieniu od klasycznych ligaz E3, wiążą się z enzymem E2, z którego pobierają ubikwitynę do określonego miejsca w obrębie domeny RING1. Następnie ubikwityna przenoszona jest na katalityczną cysteinę w domenie RING2, skąd trafia bezpośrednio na białko substratowe (Smit i wsp., 2012; Wenzel i wsp., 2011; Winklhofer, 2014). Do pełnienia funkcji ligazy białko PARKIN musi zostać uprzednio zaktywowane przez białko PINK1. Jeśli mitochondrium utraci swój potencjał błonowy, PINK1 ulega autofosforylacji, a także bezpośrednio fosforyluje PARKIN oraz substraty na powierzchni mitochondriów. Następnie aktywne PARKIN ubikwitynuje wcześniej ufosforylowane substraty, które w takim stanie są zdolne do wiązania się z białkami autofagosomalnymi – LC3 oraz białkiem p62, co rozpoczyna proces autofagii całego organellum (Ordureau i wsp., 2014; Pankiv i wsp., 2007). Mutacja genu parkin powoduje powstanie podobnego fenotypu do tego obserwowanego u mutantów pink1. U D. melanogaster mutanty tego genu wykazują spadek ilości ATP, degenerację neuronów dopaminergicznych, a także defekt morfologii mitochondriów (Sang i wsp., 2007; Yang i wsp., 2006). 
Drugą ligazą mitochondrialną, której zmutowana forma powoduje powstanie objawów PD jest MUL1 (z ang. Mitochondrial Ubiquitin Ligase 1). Podobnie jak PARKIN, jest to ligaza ubikwityny E3, posiadająca w swojej strukturze domeny RING. MUL1 klasyfikowana jest także jako ligaza w procesie SUMOilacji (Braschi i wsp., 2009). Jest to proces potranslacyjnej modyfikacji, w którym dochodzi do koniugacji białka SUMO (z ang. Small Ubiquitin-Like Modifier) z substratami, co w efekcie prowadzi fosforylacji, ubikwitynacji i stabilizacji białek. Podobnie do ubikwitynacji, jest to wieloetapowy proces obejmujący współpracę białek E1, E2 oraz E3 (Geiss-Friedlier i Melchior, 2007). MUL1 zlokalizowana jest na zewnętrznej błonie mitochondrialnej, gdzie katalizuje proces SUMOilacji białka DRP1 (z ang. Dynamin-Related Protein 1) stabilizując je oraz proces ubikwitynacji białka Mfn (z ang. Mitofusin) wyznaczając mitochondrium do degradacji (Braschi i wsp., 2009; Harder i wsp., 2004; Lokireddy i wsp., 2012). Powiązanie białka MUL1 oraz choroby Parkinsona zostało po raz pierwszy przedstawione w 2014 roku na modelu muszki owocowej. Wykazano, że MUL1 działa równolegle do białek PINK1/PARKIN promując mitofagię, natomiast jego mutacja powoduje defekt mitochondrialny podobny do obserwowanego u mutantów pink1 i parkin (Yun i wsp., 2014). 
W pracy doktorskiej do uzyskania zwierzęcego modelu choroby Parkinsona 
o charakterze sporadycznym, została użyta neurotoksyna rotenon. Jest to powszechnie stosowany, naturalnie występujący pestycyd organiczny. Rotenon jest inhibitorem o wysokim powinowactwie do pierwszego kompleksu mitochondrialnego (Degli Esposti, 1998). 
Jako substancja niezwykle lipofilna, łatwo penetruje błony komórkowe, jest niezależna od transporterów błonowych i szybko przechodzi przez barierę krew-mózg (Talpade i wsp., 2008). Po przedostaniu się do mitochondriów, łączy się on z I kompleksem oddechowym, hamując tym samym jego aktywność, co w efekcie powoduje powstanie dużych ilości wolnych rodników oraz przewlekłego stresu oksydacyjnego. Chroniczna ekspozycja szczurów na rotenon powoduje degenerację neuronów dopaminergicznych prążkowia oraz szlaku nigrostratialnego, a także utratę serotoninergicznych komórek prążkowia. Skutkuje to wystąpieniem objawów motorycznych, podobnych do tych obserwowanych u ludzi (Betarbet i wsp., 2000). U D. melanogaster rotenon stosowany jest od 2004 roku 
w stężeniu 500 µM, który powoduje degenerację neuronów dopaminergicznych, zmniejszenie poziomu dostępnej dopaminy oraz mocno zredukowaną długość życia (Coulom i Birman, 2004). 
Zegar okołodobowy 

Chorzy cierpiący na chorobę Parkinsona, poza objawami behawioralnymi mają również szereg objawów niemotorycznych. Obejmują one ból, deficyty poznawcze, depresję, zespół niespokojnych nóg czy wcześniej wspominane zaburzenia snu. Do tych ostatnich zalicza się przede wszystkim zespół zaburzeń snu REM (z ang. Rapid Eye Movement), fragmentacja snu, nadmierna senność w dzień oraz bezsenność (Suzuki i wsp., 2017). Fragmentacja i zmniejszona efektywność snu mają wpływ na jakość życia chorych i mogą przyśpieszyć rozwój PD. U osób chorych obserwuje się także nieprawidłowe zmiany w okołodobowym rytmie temperatury ciała oraz ciśnienia krwi (Li i wsp., 2017c). Ponieważ zegar okołodobowy kontroluje wyżej wymienione procesy, może istnieć powiązanie między jego nieprawidłowym funkcjonowaniem a licznymi objawami niemotorycznymi (Ahsan Ejaz i wsp., 2006; Mistlberger, 2005; Tong i wsp., 2000). Większość z wymienionych objawów behawioralnych oraz niemotorycznych jest także obserwowana u zwierzęcych modeli choroby Parkinsona. W pracy doktorskiej jeden z poruszanych aspektów dotyczył zaburzenia zegara okołodobowego u muszki owocowej prezentującej objawy PD. Jedna z testowanych hipotez zakładała, że uszkodzenie zaburzenie pracy zegara okołodobowego powoduje problemy ze snem, podobnie do tych jak u osób z PD. 
Molekularny mechanizm zegara okołodobowego u D. melanogaster opiera się na ekspresji kilku genów oraz ich białek: per (z ang. period), tim (z ang. timeless), clk (z ang. clock), cyc (z ang. cycle), cry (z ang. cryptochrome), pdp (z ang. PAR domain protein) oraz vri (z ang. vrille) (Özkaya i Rosato, 2012). Jego główny gen – per, ulega ekspresji w wielu typach komórek: siatkówce, jelicie, komórkach glejowych, jajnikach, jądrach oraz neuronach zegara (Hardin, 2005). Poziom mRNA oraz poziom białka PER zmieniają się cyklicznie w trakcie doby. Ich maksimum obserwowane jest w nocy, kiedy występuje parogodzinne przesunięcie pomiędzy szczytem ekspresji genu a białka, spowodowane obróbkami potranskrypcyjnymi (Hardin i wsp., 1990; Zeng i wsp., 1994; Zerr i wsp., 1990a). Białko PER powstaje w cytoplazmie, gdzie jako monomer ulega szybkiej fosforylacji i kierowane jest na drogę proteasomalnej degradacji (Edery i wsp., 1994; Kloss i wsp., 1998). Natomiast po utworzeniu dimeru z białkiem TIM, PER nie jest więcej fosforylowane i tym samym jego poziom w cytoplazmie wzrasta. Tim, kolejny gen zegara, ulega ekspresji w niektórych fotoreceptorach, interneuronach L1 i L2 oraz w niektórych rejonach mózgu, jak np. ciele grzybkowatym, a także w neuronach zegara (Benna i wsp., 2010). Pod wpływem światła, TIM łączy się z białkiem CRY i kierowane jest do proteasomalnej degradacji (Hunter-Ensor i wsp., 1996; Myers i wsp., 1996a). Po połączeniu z białkiem PER, heterodimer PER-TIM wraz z kinazą DBT (z ang. Double-Time) są transportowane do jądra komórkowego, gdzie następuje fosforylacja białek CLK i CYC (Gekakis i wsp., 1995; Vosshall i wsp., 1994; Zeng i wsp., 1996). Białka CLK i CYC to czynniki transkrypcyjne zbudowane między innymi z domen PAS i HLH, za pomocą których przyłączają się do sekwencji regulatorowych E-BOX w promotorach genów np. genach per i tim, aktywując ich transkrypcję (Allada i wsp., 1998; Darlington i wsp., 1998). W jądrze komórkowym obecność trimeru PER-TIM-DBT stymuluje fosforylację dimeru CLK-CYC hamując jego aktywność i kierując do degradacji białka CLK, tym samym hamując ekspresję genów per i tim (Lee i wsp., 1999; Yu i wsp., 2006). W ciągu dnia, podczas ekspozycji na światło, TIM łączy się z białkiem CRY będąc tym samym kierowane na szlak proteasomalnej degradacji (Hunter-Ensor i wsp., 1996). Heterodimery PER-TIM nie są tworzone, co skutkuje ponownym przyłączeniem się białek CLK-CYC do sekwencji E-BOX i wznowieniu transkrypcji per i tim (Yu i wsp., 2007). Druga pętla zegara okołodobowego opiera się na ekspresji genów vri i pdp. białka CLK i CYC regulują ekspresję genów vri oraz pdp. VRI ulega translacji w jądrze komórkowym, gdzie rozpoznaje sekwencję V/P BOX w promotorze genu clk, następnie łączy się z nią i tym samym hamuje ekspresję tego genu. Translacja PDP jest opóźniona w stosunku do VRI. Jest to antagonista VRI, a wiążąc się do V/P BOX wznawia transkrypcję clk (Yu i wsp., 2007). Nadrzędny, okołodobowy zegar 
D. melanogaster, tworzy 150 neuronów, które są zgrupowane w różnych rejonach mózgu. Zalicza się do nich: neurony brzuszne boczne o dużych ciałach komórkowych lLNvs (z ang. Large Ventral Lateral Neurons), neurony brzuszne boczne o małych ciałach komórkowych sLNvs (z ang. Small Ventral Lateral Neurons), neurony grzbietowe boczne LNd (z ang. Lateral Dorsal Neurons), neurony grzbietowe DN (z ang. Dorsal Neurons) oraz neurony boczne tylne LPN (z ang. Lateral Posterior Neurons) (Helfrich-Förster, 1998; Kaneko i wsp., 1997; Siwicki i wsp., 1988a; Zerr i wsp., 1990b). Głównym neuropeptydem zegara, służącym do koordynowania porannych i wieczornych szczytów aktywności, jest PDF (z ang. Pigment Dispersing Factor) (Renn i wsp., 1999). Informacja o zmianach ekspresji 
genów zegara jest przekazywana szlakami eferentnymi (drogą synaptyczną, między innymi przez PDF) oraz pozasynaptycznymi do komórek niezwiązanych bezpośrednio z zegarem, ustalając tym samym ich okołodobowy profil. Kontrolując ekspresję wielu genów -ccg (z ang. Clock–controlled gens), zegar okołodobowy jest w stanie regulować aktywności komórek i tkanek oraz różne procesy biologiczne, fizjologiczne i behawioralne, takie jak aktywność lokomotoryczna i sen. 
Plastyczność synaptyczna 

Objawy behawioralne i niemotoryczne występujące w PD mogą być następstwem uszkodzenia neuronów, jak również zaburzonej komunikacji neuronalnej, za którą odpowiedzialne są synapsy. Plastyczność synaptyczna to zdolność synaps do zmian w ich funkcjonowaniu oraz budowie w odpowiedzi na spadek bądź wzrost ich aktywności (Hughes, 1958). Drugi z poruszanych aspektów w pracy doktorskiej dotyczy zaburzenia 
w funkcjonowaniu synaps w patogenezie choroby. W tej części pracy, próbowano zweryfikować hipotezę, czy poprawa kondycji mitochondriów poprzez zastosowanie manipulacji genetycznych będzie skutkować zahamowaniem uszkodzenia synaps i neuronów w rozwoju choroby Parkinsona. 
Plastyczność synaptyczna w określonych obszarach mózgu była szczegółowo badana w patologii PD, a jej zmiany po degeneracji neuronów dopaminergicznych są krytyczne dla rozwoju choroby. W modelach zwierzęcych spadek poziomu dopaminy indukuje szybką i znaczną utratę kolców dendrytycznych i synaps glutaminergicznych w prążkowiu (Day i wsp., 2006). Dopamina odgrywa także istotną rolę w dwukierunkowej plastyczności w ośrodkowych neuronach kolczystych w warunkach fizjologicznych, natomiast w PD plastyczność ta jest zaburzona (Shen i wsp., 2008). Większość badań nad chorobą Parkinsona skupia się na badaniu prążkowia i neuronów tam zlokalizowanych,z uwagi na największą gęstość unerwienia dopaminergicznego w tej strukturze (Graybiel, 1990). Wykazano, że gęstość kolców dendrytycznych w neuronach prążkowia maleje wraz z rozwojem choroby Parkinsona (Nishijima i wsp., 2014). W zwierzęcych modelach choroby zarówno długotrwałe wzmocnienie synaptyczne – LTP (z ang. Long-term Potentiation) jak i długotrwałe obniżenia synaptyczne – LTD (z ang. Long-term Depression) są nieobecne w średnich neuronach kolczystych (Calabresi i wsp., 2007; Kreitzer i Malenka, 2007). Przywrócenie LTP w tych samych neuronach jest możliwe poprzez zastosowanie kuracji lewodopy (Picconi i wsp., 2003). Wiele badań wykazało także, że kora ruchowa również jest uszkodzona w PD. Ostatnie badania donoszą o nieprawidłowej przebudowie sieci neuronalnej w korze ruchowej u różnych modeli choroby (Guo i wsp., 2015). Stwierdzono, że w warstwie V kory ruchowej dochodzi do znaczącej eliminacji i nieprawidłowego formowania dendrytów, co w efekcie powoduje zmniejszenie objętości tkanki. Również LTP oraz LTD w korze ruchowej jest silnie zredukowane (Eggers i wsp., 2010; Suppa i wsp., 2011; Ueki i wsp., 2006), co może być przyczyną niefunkcjonalnych receptorów dopaminowych (Molina-Luna i wsp., 2009). Powyższe doniesienia wskazują na fakt, że zredukowanie plastyczności synaptycznej oraz uszkodzenie synaps w obrębie kory ruchowej mogą być bezpośrednią przyczyną objawów motorycznych w chorobie Parkinsona. W niniejszej pracy scharakteryzowane zostały również strukturalne uszkodzenia synaptyczne u modelu 
sporadycznego jak i genetycznego PD. 
Cel pracy 

Celem prezentowanej rozprawy doktorskiej było poznanie roli dwóch ligaz mitochondrialnych MUL1 oraz PARKIN w rozwoju choroby Parkinsona z wykorzystaniem modelu D. melanogaster. Scharakteryzowano powiązanie PD z zaburzeniami zegara okołodobowego, który odpowiada za kontrolę rytmiki snu i czuwania oraz opisano możliwy mechanizm tego zaburzenia. Przedmiotem badań było także ustalenie czy zwiększenie ekspresji badanych ligaz mitochondrialnych wpłynie protekcyjnie na neurony wystawiane na działanie rotenonu. Przy zastosowaniu technik mikroskopowych oraz technik biologii molekularnej badano strukturalne nieprawidłowości synaps na modelach genetycznych i sporadycznych choroby Parkinsona u D. melanogaster. 
Dyskusja 

W rozprawie doktorskiej pt. „Rola wybranych białek mitochondrialnych w chorobie Parkinsona -badania na modelu Drosophila melanogaster” wykazano, że zaburzenia zegara okołodobowego odgrywają ważną rolę w patogenezie choroby Parkinsona. W badaniach wykorzystano modele genetyczne – mutacje genów mul1 oraz park, w celu scharakteryzowania możliwego mechanizmu tego zaburzenia. Dodatkowo, w osobnym cyklu prowadzonych badań, wykazano rolę ligaz MUL1 i PARK w neuroprotekcji w PD, z wykorzystaniem sporadycznego modelu choroby poprzez ekspozycję D. melanogaster na rotenon. Scharakteryzowano także molekularne i strukturalne (poprzez wykorzystanie elektronowej mikroskopii transmisyjnej) uszkodzenie synaps wywołane wpływem rotenonu oraz mutacji pink1. Zestawienie wyników otrzymanych z przeprowadzonych eksperymentów pozwala na bardziej dokładne poznanie patogenezy choroby Parkinsona oraz tłumaczy, że zaburzenie zegara biologicznego oraz mitofagii są najprawdopodobniej przyczyną problemów ze snem oraz obumierania neuronów występujących w trakcie trwania choroby. 
W ramach przygotowania niniejszej rozprawy doktorskiej opublikowano trzy oryginalne publikacje naukowe o zasięgu międzynarodowym. W pierwszej z nich „Effects of MUL1 and PARKIN on the circadian clock, brain and behaviour in Drosophila Parkinson’s disease models” zbadano rolę zaburzenia zegara okołodobowego w rozwoju choroby Parkinsona. Głównym założeniem pracy było sprawdzenie czy zaburzenia snu, które występują u chorych, mogą wynikać z nieprawidłowo funkcjonującego zegara okołodobowego. W pracy jako model wykorzystano szczepy D. melanogaster z mutacją genu mul1 oraz park, wykazujące typowe objawy PD. Mutacje tych genów prowadzą do zmniejszenia ilości mitochondriów oraz zwiększenia ich wymiarów (Park i wsp., 2006a; Yun i wsp., 2014). Udowodniono, że u mutantów mul1 i park występuje wyższy poziom wolnych rodników, co jest wynikiem występowania uszkodzonych mitochondriów w komórkach, jak również zmniejszony poziom endogennego antyoksydantu – SOD 1, który odpowiada za ich rozkład (Bunton-Stasyshyn i wsp., 2015). U mutantów wykryto również mniejszy poziom białka ATG5 (z ang. Autophagy-related 5), odpowiedzialnego za prawidłowy przebieg procesu autofagii. Zahamowanie procesu autofagii zwiększa liczbę uszkodzonych organelli i białek komórkowych, co w rezultacie wzmaga proces degeneracji komórki (Henchcliffe i Beal, 2008). Z drugiej strony, wyniki innych autorów wykazały, że wzmożony stres oksydacyjny stymuluje proces autofagii w celu usunięcia uszkodzonych białek, 
które mogą być źródłem stresu oksydacyjnego (Li i wsp., 2017a; Matus i wsp., 2008). Natomiast przewlekły stres oksydacyjny powoduje defekt autofagii, co również potwierdzają prezentowane wyniki (Cai i Liu, 2012). 
W kolejnym etapie badań wykazano, że długość życia badanych mutantów jest krótsza, a czas snu zredukowany. Skrócenie długości życia u mutantów jest najprawdopodobniej konsekwencją zahamowania autofagii. Wyniki innych autorów sugerują, że redukcja poziomu innego białka zaangażowanego w autofagię -ATG9 również skraca długość życia (Wen i wsp., 2017). Oprócz skróconego czasu życia, u mutantów zaobserwowano także zwiększoną aktywność lokomotoryczną i zaburzenia snu. Ponadto mutacja park zwiększa poziom aktywności muszki owocowej w ciągu dnia (Julienne i wsp., 2017), co również potwierdziły prezentowane wyniki (dla mutantów park oraz dodatkowo mutantów mul1). Jak wspomniano wcześniej, sen jest regulowany przez zegar okołodobowy (Cavanaugh i wsp., 2016; Zhou i wsp., 2014), a u muszki owocowej kontrolowany za pośrednictwem PDF-pozytywnych neuronów lLNvs (Parisky i wsp., 2008). Pokazuje to, że zaburzenia snu mogą prawdopodobnie wynikać z zahamowania autofagii w tej grupie neuronów, co prezentowane wyniki. W kolejnym etapie badań scharakteryzowano molekularne zmiany w zegarze biologicznym u mutantów park i mul1. Po pierwsze, stwierdzono, że w przypadku mutacji park następuje parogodzinne przesunięcie w fazie rytmu i szczytu poziomu mRNA genów per i tim oraz zmiany w dobowej ekspresji clk. Z kolei u mutantów mul1 zaobserwowano zmiany w poziomie ekspresji genów zegara, podczas gdy ich rytm został zachowany. Pomimo faktu, że u obu mutantów rytmika ekspresji badanych genów była wyraźna, rytm zmian poziomu białka PER jest całkowicie zniesiony. Różnice pomiędzy transkrypcją, a translacją PER mogą wynikać z nieprawidłowo działających czynników translacyjnych, co może powodować wysoki poziom ROS. Badania innych autorów potwierdziły, że zwiększona aktywność czynnika translacyjnego eIF2α (z ang. Eukaryotic Initiation Factor 2) wzmaga ekspresję PER (Lee i wsp., 2018). Wysoki poziom stresu oksydacyjnego może także degradować białko SLIMB, odpowiedzialnego za degradację PER w proteasomach (Grima i wsp., 2002). Niska aktywność SLIMB może zahamować degradację PER, zwiększając w ten sposób jego poziom i zmieniając profil jego ekspresji. Wolne rodniki mogą także bezpośrednio „resetować” zegar okołodobowy poprzez modyfikację aktywności kinazy kazeinowej CK2 (z ang. Casein Kinase 2) (Tamaru i wsp., 2013). CK2 fosforyluje PER i TIM oraz reguluje ich poziom w czasie potranslacyjnej modyfikacji PER (Lin i wsp., 2002). Wolne rodniki mogą również wpływać na ekspresję genów zegara. U ssaków wysoki poziom ROS powoduje silną 
indukcję ekspresji genów zegara (Tahara i Shibata, 2018). Wolne rodniki mogą także 
degradować czynniki transkrypcyjne, regulujące ekspresję genów zegara i białek stabilizujących mRNA, takich jak kinaza NEMO, VRILLE czy PDP1 (Akten i wsp., 2003; Cyran i wsp., 2003; Kloss i wsp., 1998). Zaburzenie zegara może być także spowodowana wcześniej wspominanym wpływem stresu oksydacyjnego i zahamowaniem autofagii w komórkach zegara. Wspólna lokalizacja białek ATG5 i PDF w ciele komórkowym neuronów lLNvs zaobserwowana w obecnych badaniach, wskazuje, że białka zegara mogę także być degradowane na drodze autofagii. W tej grupie neuronów wszystkie badane geny ulegają ekspresji, podobnie jak zmiany poziomu białka PER (Myers i wsp., 1996b; Siwicki i wsp., 1988b; Zerr i wsp., 1990a). Ponadto zaobserwowano, że poziom ATG5 w tych neuronach jest mniejszy u obu mutantów niż u szczepów kontrolnych, co potwierdza związek molekularnego mechanizmu zegara z autofagią. Mutanty mul1 prezentowały także zmniejszony poziom badanego białka względem mutantów park, co najprawdopodobniej spowodowane jest różnymi funkcjami tych białek. Pomimo, że są to ligazy mitochondrialne zaangażowane w mitofagię, MUL1 uczestniczy także w SUMOilacji, za pośrednictwem którego różne białka są stabilizowane np. transporter glukozy czy α-synukleina (Dorval i Fraser, 2006; Giorgino i wsp., 2000). SUMOilacja zabezpiecza również białka przed wpływem wolnych rodników (Marcelli i wsp., 2018), więc jej zahamowanie tłumaczy zwiększoną wrażliwość białek na stres oksydacyjny. Podsumowując, w tym artykule wykazano, że mutacje genów mul1 i park, biorące udział w patogenezie choroby Parkinsona, zakłócają pewne procesy fizjologiczne, w tym molekularny mechanizm zegara okołodobowego, co z kolei wpływa na sen. Prawdopodobnie efekt ten wynika ze zwiększonego poziomu wolnych rodników i zahamowania autofagii, co jest kluczowe w generowaniu rytmów okołodobowych. 
W kolejnym artykule zatytułowanym „Overexpression of Mitochondrial Ligases Reverses Rotenone-Induced Effects in a Drosophila Model of Parkinson’s Disease” opisano potencjalną metodę neuroprotekcji w chorobie Parkinsona. Głównym założeniem było zweryfikowanie czy zwiększenie poziomu mitofagii przez nadekspresję ligaz MUL1 i PARK będzie wpływało protekcyjnie na synapsy i neurony w PD. Do wywołania objawów choroby wykorzystano w tym przypadku wcześniej opisywaną neurotoksynę – rotenon. W badaniach udowodniono, że mechanizm działania rotenonu jest podobny do mechanizmu wywołanego mutacjami genów mul1 oraz park, który opisano w poprzednim artykule. Ekspozycja na 500 µM rotenon (Coulom i Birman, 2004) zmniejszyła poziom białek ATG5 oraz SOD1. 
Udowodniono także, że rotenon wpływa na apoptozę zwiększając poziom białka Dcp-1 (z ang. Death caspase-1) (Xu i wsp., 2009). W badaniach innych autorów zaobserwowano także, że neurotoksyna indukuje zmiany w poziomie kliku innych białek apoptotycznych, takich jak Bcl2, Bax, kaspaza-8 i cytochrom C (Dhanalakshmi i wsp., 2016) oraz, że autofagia zapobiega apoptozie zależnej od stresu oksydacyjnego (Li i wsp., 2017b). W dalszych badaniach wykazano, że rotenon obniża zdolność muszek owocowych do wspinania się i ich aktywność lokomotoryczną w ciągu dnia. Jest to najprawdopodobniej spowodowane zwiększonym poziomem wolnych rodników i apoptozą (Rosińczuk i wsp., 2018), a także degeneracją neuronów. We wcześniej pracach pokazano również, że stres oksydacyjny wpływa na zachowanie (Camargo i wsp., 2018). W prezentowanych badaniach udowodniono, że nadekspresja ligaz MUL1 i PARK w neuronach przywraca prawidłowy poziom autofagii, apoptozy i endogennego antyoksydantu, co w rezultacie przekłada się na kolejny wynik – poprawę wspinaczki oraz aktywności lokomotorycznej. Zaburzenia motoryczne mogą także wynikać z uszkodzonych synaps w układzie nerwowym i połączeń nerwowomięśniowych po ekspozycji na rotenon. Zaobserwowano, że rotenon zmniejsza poziom kilku białek związanych z transmisją synaptyczną: Dlg1 (z ang. Discs Large 1), synapsyny oraz synaptotagminy. Dlg1 odpowiedzialne jest za grupowanie receptorów neurotransmiterów i kanałów jonowych w błonie postsynaptycznej i pośredniczenie w adhezji komórkowej (Kim i wsp., 2014). Synapsyna jest ważnym białkiem grupującym pęcherzyki synaptyczne w miejscu presynaptycznym i regulującym plastyczność synaptyczną 
Ca2+

(Vasin i wsp., 2014). Z kolei synaptotagmina działa jak czujnik i odpowiada za egzocytozę neuroprzekaźnika (Geppert i wsp., 1994). Niski poziom synapsyny bądź synaptotagminy prowadzi do słabej transmisji synaptycznej i zaburzeń motorycznych (Lai i wsp., 2015; Sampedro-Piquero i wsp., 2014). Co więcej, niski poziom białek synaptycznych jest także skorelowany z wysokim poziomem wolnych rodników, które jak opisano powyżej, nasilają apoptozę i zmniejszają autofagię. Niski poziom białek synaptycznych wynika także ze słabej aktywności czynników translacyjnych, biorących udział w translacji tych białek, za co również odpowiedzialny jest stres oksydacyjny (Lee i wsp., 2018). Jak pokazują prezentowane wyniki, rotenon zmniejsza poziom białek ATG5, SOD1, podczas gdy ekspresja ich genów pozostaje prawidłowa. Aby podkreślić, że rotenon uszkadza synapsy, ich strukturę zanalizowano w transmisyjnym mikroskopie elektronowym. Zbadano morfologię elementów presynaptycznych w synapsach tetradycznych, w pierwszym neuropilu płata wzrokowego D. melanogaster. Synapsy te przekazują informacje wzrokowe z fotoreceptorów oka do interneuronów płata wzrokowego mózgu. Stwierdzono, że rotenon wpływa na morfologię pęcherzyków synaptycznych oraz stref aktywnych, odpowiedzialnych za egzocytozę neuroprzekaźnika do szczeliny 
synaptycznej. Strefa aktywna w presynaptycznem elemencie synapsy jest miejscem, 
w którym dochodzi do fuzji pęcherzyka synaptycznego z błoną presynaptyczną pod wpływem wzrostu stężenia jonów wapnia (Wichmann i Sigrist, 2010). Prawidłowy rozwój synaps jest także zależny od autofagii (Shen i Ganetzky, 2009), która jest obniżona przez działanie rotenonu, a także od wpływu wolnych rodników (Kamat i wsp., 2016; Milton i Sweeney, 2012). Zmian w synapsach spowodowanych rotenonem nie odnotowano u szczepów z nadekspresją ligaz MUL1 i PARK. Strefy aktywne wyglądały prawidłowo w obu przypadkach, a pęcherzyki synaptyczne były okrągłe, elektronowo gęste, co jest typowe dla prawidłowych synaps. W kolejnym eksperymencie zbadana została liczba neuronów dopaminergicznych u szczepów z nadekspresją w/w ligaz po ekspozycji na rotenon. Wcześniej opublikowane wyniki innych naukowców wykazały, że rotenon w stężeniu 500 µM wywołuje degenerację neuronów dopaminergicznych u muszki owocowej (Coulom i Birman, 2004). Spadek liczby neuronów jest skorelowany ze spadkiem poziomu dopaminy, co prawdopodobnie prowadzi do problemów motorycznych (Santiago i wsp., 2014; Smith i wsp., 2013). Zaobserwowano zmniejszoną liczbę neuronów dopaminowych po ekspozycji na rotenon, podczas gdy nadekspresja ligaz mitochondrialnych w neuronach 
szczepów karmionych rotenonem chroniła przed jego toksycznością i zapobiegała procesom neurodegeneracyjnym. Podsumowując, w niniejszym artykule wykazano że rotenon w stężeniu 500 µM zmniejsza poziom autofagii, a zwiększa apoptozę i ilość wolnych rodników. Prowadzi to do zaburzenia funkcji i morfologii synaps, aktywności lokomotorycznej oraz zmniejsza liczbę neuronów dopaminergicznych w mózgu 
D. melanogaster. Udowodniono także, że nadekspresja dwóch głównych ligaz mitochondrialnych we wszystkich neuronach działa protekcyjnie, ponieważ hamuje działanie rotenonu. Neurodegeneracja wydaje się zależeć nie tylko od braku ATP z powodu uszkodzonych mitochondriów, ale także z powodu ich niszczącego działania w komórce. 
W ostatnim artykule, stanowiącym część prezentowanej rozprawy doktorskiej, pt. „Effects of PINK1 mutation on synapses and behavior in the brain of Drosophila melanogaster” zbadano zmiany morfologiczne synaps w genetycznym modelu choroby Parkinsona. Założeniem tej pracy było zweryfikowanie czy genetyczne modele choroby wykazują podobne uszkodzenie synaps jak modele sporadyczne (ekspozycja na rotenon). 
W tym przypadku jako model genetyczny wykorzystano szczepy D. melanogaster z mutacją genu kodującego białko PINK1. Mutacja pink1 u muszki owocowej powoduje zmiany morfologii mitochondriów (Clark i wsp., 2006; Park i wsp., 2006c), prowadzące do zmniejszonej ilości dostępnej energii w postaci ATP (Liu i wsp., 2011), co przekładać się może na zaburzenia behawioralne i niemotoryczne. Ponadto u mutantów pink1 zaobserwowano defekt morfologiczny mięśni odpowiadających za lot (Park i wsp., 2006c) oraz apoptozę tych komórek (Clark i wsp., 2006). Park i wsp. (2006c) stwierdzili, że mutacja ta nie tylko powoduje zaburzenia ruchowe i obniża aktywność lokomotoryczną, ale także wpływa na synapsy i aktywność synaptyczną w mózgu. Wykazano, że mutanty mają też nieprawidłowy profil snu, a ich całkowita aktywność mierzona w trakcie 24 godzin jest obniżona. Wyniki te sugerują rolę PINK1 w utrzymaniu cyklu snu i czuwania. Co ciekawe, zmiany aktywności zaobserwowano tylko w ciągu dnia, kiedy liczba mitochondriów jest największa. Na podstawie tych wyników możemy wnioskować, że cykl snu/aktywność D. melanogaster w ciągu dnia jest najprawdopodobniej skorelowana z obniżeniem aktywności mitochondriów w komórkach mózgu w ciągu dnia. W kolejnych badaniach stwierdzono, że mutacja pink1 wpływa na synapsy poprzez zmniejszenie ilości presynaptycznego białka BRP (z ang. Bruchpilot), budującego strefę aktywną oraz odpowiedzialnego za egzocytozę neuroprzekaźnika (Wagh i wsp., 2006), a także innych białek zaangażowanych w transmisję synaptyczną. Wykazano, że mutacja pink1 zmniejsza ilość białka BRP zarówno w mózgu, jak również w poprzednio opisywanych synapsach tetradycznych układu wzrokowego. W synapsach tetradycznych białko BRP ulega dobowym zmianom, które skorelowane są ze zmianami liczby elementów presynaptycznych (Górska-Andrzejak i wsp., 2013) Jednak dobowy rytm zmian BRP utrzymywany jest u szczepów z badaną mutacją. Fakt, że dobowa ekspresja białka BRP w synapsach tetradycznych nie ulega zmianie jest zaskakująca, ponieważ zaangażowanie mitochondriów w neuroplastyczność i plastyczność synaptyczną jest dobrze udokumentowane. Ponieważ taki sam wynik zmian BRP stwierdzono również w homogenacie otrzymanym z całego mózgu, upośledzenie synaps występuje prawdopodobnie także w synapsach nerwowo-mięśniowych, w których białko BRP również występuje (Wagh i wsp., 2006). Uszkodzenie synaps potwierdzają dodatkowo mikrofotografie z mikroskopu elektronowego, pokazujące pęknięte pęcherzyki synaptyczne i mniejsze strefy aktywne u mutantów pink1. Wyniki te wskazują na fakt, że mutacja pink1 wpływa na transmisję synaptyczną, najprawdopodobniej przez zwiększoną produkcję wolnych rodników (Chien i wsp., 2013), które bezpośrednie powodują uszkodzenie układu nerwowego. Wagh i wsp. wykazali, że szczepy ze zredukowaną ilością białka BRP mają podobne problemy motoryczne do tych obserwowanych w prezentowanych badaniach (Wagh i wsp., 2006). W badaniach opisanych w niniejszym artykule wykazano, że białko PINK1 jest niezbędne do utrzymania prawidłowego profilu snu w ciągu dnia i nocy, a także do odpowiedniej aktywności i morfologii synaps. Brak tego białka powoduje zmniejszenie ilości białek synaptycznych oraz zmiany ich morfologii, co w rezultacie najprawdopodobniej prowadzi do wcześniej opisanych zaburzeń motorycznych. 
Wnioski 

Wyniki uzyskane w prezentowanej rozprawie doktorskiej pozwalają na sformułowanie następujących wniosków : 
1) 	Białka MUL1 i PARK zaangażowane są w prawidłowe funkcjonowanie zegara okołodobowego u D. melanogaster. Mutacje ich genów powodują parogodzinne przesunięcie w rytmicznej ekspresji głównych genów zegara, a także znoszą rytm zmian poziomu białka PER, co łącznie skutkuje wydłużonym okresem rytmu aktywności lokomotorycznej. 
2) Białka MUL1 i PARK odpowiadają za utrzymanie prawidłowego procesu autofagii 
oraz eliminacji uszkodzonych mitochondriów, które są źródłem wolnych rodników. 
3) Nieprawidłowe funkcjonowanie zegara okołodobowego w chorobie Parkinsona 

najprawdopodobniej jest przyczyną obserwowanych problemów ze snem. 
4) 	Białka zegara najprawdopodobniej są również degradowane na drodze autofagii. Tłumaczy to obecności białka ATG5 w neuronach lLNvs oraz fakt, że w genetycznych modelach PD poziom białka ATG5 w tych neuronach jest zmniejszony, a molekularny 
zegar uszkodzony. 

5) 	Nadekspresja genów kodujących MUL1 i PARK wpływa protekcyjnie na neurony i synapsy w sporadycznym modelu choroby Parkinsona wywołanym rotenonem. Degeneracja neuronów dopaminergicznych w mózgu jest zahamowana, jak również zmiany w morfologii i funkcjonowaniu synaps nie są obserwowane pomimo ekspozycji na neurotoksynę. 
6) 	Nadekspresja ligaz mitochondrialnych MUL1 i PARK przywraca prawidłową autofagię, apoptozę oraz ilość SOD1 podczas stosowania rotenonu. 
7) 	Białko PINK1 jest niezbędne do prawidłowego funkcjonowania synaps oraz utrzymaniu ich prawidłowej morfologii, jak również jest niezbędne do utrzymania prawidłowego profilu rytmu snu i aktywności lokomotorycznej. 
Piśmiennictwo 

Ahsan Ejaz, A., Sekhon, I. S., i Munjal, S. (2006). Characteristic findings on 24-h ambulatory blood pressure monitoring in a series of patients with Parkinson’s disease. Eur. J. Intern. Med. 17, 417–420. doi:10.1016/j.ejim.2006.02.020. 
Akten, B., Jauch, E., Genova, G. K., Kim, E. Y., Edery, I., Raabe, T., i wsp. (2003). A role for CK2 in the Drosophila circadian oscillator. Nat. Neurosci. 6, 251–257. doi:10.1038/nn1007. 
Allada, R., White, N. E., So, W. V, Hall, J. C., i Rosbash, M. (1998). A mutant Drosophila homolog of mammalian Clock disrupts circadian rhythms and transcription of period and timeless. Cell 93, 791–804. Available at: http://www.ncbi.nlm.nih.gov/pubmed/9630223 [Accessed December 10, 2018]. 
Benna, C., Bonaccorsi, S., Wülbeck, C., Helfrich-Förster, C., Gatti, M., Kyriacou, C. P., i wsp. (2010). Drosophila timeless2 Is Required for Chromosome Stability and Circadian Photoreception. Curr. Biol. 20, 346–352. doi:10.1016/j.cub.2009.12.048. 
Betarbet, R., Sherer, T. B., MacKenzie, G., Garcia-Osuna, M., Panov, A. V., i Greenamyre, J. 
T. (2000). Chronic systemic pesticide exposure reproduces features of Parkinson’s disease. Nat. Neurosci. 3, 1301–1306. doi:10.1038/81834. 
Braschi, E., Zunino, R., i McBride, H. M. (2009). MAPL is a new mitochondrial SUMO E3 ligase that regulates mitochondrial fission. EMBO Rep. 10, 748–754. doi:10.1038/embor.2009.86. 
Bunton-Stasyshyn, R. K. A., Saccon, R. A., Fratta, P., i Fisher, E. M. C. (2015). SOD1 Function and Its Implications for Amyotrophic Lateral Sclerosis Pathology. Neurosci. 21, 519–529. doi:10.1177/1073858414561795. 
Cai, D., i Liu, T. (2012). Inflammatory cause of metabolic syndrome via brain stress and NFκB. Aging (Albany. NY). 4, 98–115. doi:10.18632/aging.100431. 
Calabresi, P., Picconi, B., Tozzi, A., i Di Filippo, M. (2007). Dopamine-mediated regulation of corticostriatal synaptic plasticity. Trends Neurosci. 30, 211–219. doi:10.1016/j.tins.2007.03.001. 
Camargo, A., Dalmagro, A. P., Rikel, L., da Silva, E. B., Simão da Silva, K. A. B., i Zeni, A. 
L. B. (2018). Cholecalciferol counteracts depressive-like behavior and oxidative stress induced by repeated corticosterone treatment in mice. Eur. J. Pharmacol. 833, 451–461. doi:10.1016/j.ejphar.2018.07.002. 
Cavanaugh, D. J., Vigderman, A. S., Dean, T., Garbe, D. S., i Sehgal, A. (2016). The Drosophila Circadian Clock Gates Sleep through Time-of-Day Dependent Modulation of Sleep-Promoting Neurons. Sleep 39, 345–356. doi:10.5665/sleep.5442. 
Chen, Y., i Dorn, G. W. (2013). PINK1-phosphorylated mitofusin 2 is a Parkin receptor for culling damaged mitochondria. Science 340, 471–5. doi:10.1126/science.1231031. 
Chien, W. L., Lee, T. R., Hung, S. Y., Kang, K. H., Wu, R. M., Lee, M. J., i wsp. (2013). Increase of oxidative stress by a novel PINK1 mutation, P209A. Free Radic. Biol. Med. 58, 160–169. doi:10.1016/j.freeradbiomed.2012.12.008. 
Ciechanover, A. (2005). Proteolysis: from the lysosome to ubiquitin and the proteasome. Nat. Rev. Mol. Cell Biol. 6, 79–87. doi:10.1038/nrm1552. 
Clark, I. E., Dodson, M. W., Jiang, C., Cao, J. H., Huh, J. R., Seol, J. H., i wsp. (2006). Drosophila pink1 is required for mitochondrial function and interacts genetically with parkin. Nature 441, 1162–1166. doi:10.1038/nature04779. 
Coulom, H., i Birman, S. (2004). Chronic Exposure to Rotenone Models Sporadic Parkinson’s Disease in Drosophila melanogaster. J. Neurosci. 24, 10993–10998. doi:10.1523/JNEUROSCI.2993-04.2004. 
Cyran, S. A., Buchsbaum, A. M., Reddy, K. L., Lin, M.-C., Glossop, N. R. J., Hardin, P. E., i wsp. (2003). vrille, Pdp1, and dClock form a second feedback loop in the Drosophila circadian clock. Cell 112, 329–41. Available at: http://www.ncbi.nlm.nih.gov/pubmed/12581523 [Accessed May 15, 2018]. 
Darlington, T. K., Wager-Smith, K., Ceriani, M. F., Staknis, D., Gekakis, N., Steeves, T. D., i wsp. (1998). Closing the circadian loop: CLOCK-induced transcription of its own inhibitors per and tim. Science 280, 1599–603. Available at: http://www.ncbi.nlm.nih.gov/pubmed/9616122 [Accessed December 10, 2018]. 
Day, M., Wang, Z., Ding, J., An, X., Ingham, C. A., Shering, A. F., i wsp. (2006). Selective elimination of glutamatergic synapses on striatopallidal neurons in Parkinson disease models. Nat. Neurosci. 9, 251–259. doi:10.1038/nn1632. 
Deas, E., Plun-Favreau, H., Gandhi, S., Desmond, H., Kjaer, S., Loh, S. H. Y., i wsp. (2011). PINK1 cleavage at position A103 by the mitochondrial protease PARL. Hum. Mol. Genet. 20, 867–879. doi:10.1093/hmg/ddq526. 
Degli Esposti, M. (1998). Inhibitors of NADH–ubiquinone reductase: an overview. Biochim. Biophys. Acta -Bioenerg. 1364, 222–235. doi:10.1016/S0005-2728(98)00029-2. 
Del Tredici, K., i Braak, H. (2012). Lewy pathology and neurodegeneration in premotor Parkinson’s disease. Mov. Disord. 27, 597–607. doi:10.1002/mds.24921. 
DeMaagd, G., i Philip, A. (2015). Parkinson’s Disease and Its Management: Part 1: Disease Entity, Risk Factors, Pathophysiology, Clinical Presentation, and Diagnosis. P T 40, 504–32. Available at: http://www.ncbi.nlm.nih.gov/pubmed/26236139 [Accessed December 4, 2018]. 
Dhanalakshmi, C., Janakiraman, U., Manivasagam, T., Justin Thenmozhi, A., Essa, M. M., Kalandar, A., i wsp. (2016). Vanillin Attenuated Behavioural Impairments, Neurochemical Deficts, Oxidative Stress and Apoptosis Against Rotenone Induced Rat Model of Parkinson’s Disease. Neurochem. Res. 41, 1899–1910. doi:10.1007/s11064016-1901-5. 
Dorval, V., i Fraser, P. E. (2006). Small Ubiquitin-like Modifier (SUMO) Modification of Natively Unfolded Proteins Tau and α-Synuclein. J. Biol. Chem. 281, 9919–9924. doi:10.1074/jbc.M510127200. 
Driver, J. A., Logroscino, G., Gaziano, J. M., i Kurth, T. (2009). Incidence and remaining lifetime risk of Parkinson disease in advanced age. Neurology 72, 432–438. doi:10.1212/01.wnl.0000341769.50075.bb. 
Edery, I., Rutila, J. E., i Rosbash, M. (1994). Phase shifting of the circadian clock by induction of the Drosophila period protein. Science 263, 237–40. Available at: http://www.ncbi.nlm.nih.gov/pubmed/8284676 [Accessed December 10, 2018]. 
Eggers, C., Fink, G. R., i Nowak, D. A. (2010). Theta burst stimulation over the primary motor cortex does not induce cortical plasticity in Parkinson’s disease. J. Neurol. 257, 1669–1674. doi:10.1007/s00415-010-5597-1. 
Eiyama, A., i Okamoto, K. (2015). PINK1/Parkin-mediated mitophagy in mammalian cells. Curr. Opin. Cell Biol. 33, 95–101. doi:10.1016/j.ceb.2015.01.002. 
Feany, M. B., i Bender, W. W. (2000). A Drosophila model of Parkinson ’ s disease. 404. 
Geiss-Friedlander, R., i Melchior, F. (2007). Concepts in sumoylation: a decade on. Nat. Rev. Mol. Cell Biol. 8, 947–956. doi:10.1038/nrm2293. 
Gekakis, N., Saez, L., Delahaye-Brown, A. M., Myers, M. P., Sehgal, A., Young, M. W., i wsp. (1995). Isolation of timeless by PER protein interaction: defective interaction between timeless protein and long-period mutant PERL. Science 270, 811–5. Available at: http://www.ncbi.nlm.nih.gov/pubmed/7481773 [Accessed December 10, 2018]. 
Geppert, M., Goda, Y., Hammer, R. E., Li, C., Rosahl, T. W., Stevens, C. F., i wsp. (1994). Synaptotagmin I: a major Ca2+ sensor for transmitter release at a central synapse. Cell 79, 717–27. Available at: http://www.ncbi.nlm.nih.gov/pubmed/7954835 [Accessed September 12, 2018]. 
Giorgino, F., de Robertis, O., Laviola, L., Montrone, C., Perrini, S., McCowen, K. C., i wsp. (2000). The sentrin-conjugating enzyme mUbc9 interacts with GLUT4 and GLUT1 glucose transporters and regulates transporter levels in skeletal muscle cells. Proc. Natl. Acad. Sci. U. S. A. 97, 1125–30. Available at: http://www.ncbi.nlm.nih.gov/pubmed/10655495 [Accessed May 15, 2018]. 
Górska-Andrzejak, J., Makuch, R., Stefan, J., Görlich, A., Semik, D., i Pyza, E. (2013). Circadian expression of the presynaptic active zone protein bruchpilot in the lamina of Drosophila melanogaster. Dev. Neurobiol. 73, 14–26. doi:10.1002/dneu.22032. 
Graybiel, A. M. (1990). Neurotransmitters and neuromodulators in the basal ganglia. Trends Neurosci. 13, 244–54. Available at: http://www.ncbi.nlm.nih.gov/pubmed/1695398 [Accessed December 11, 2018]. 
Greene, A. W., Grenier, K., Aguileta, M. a, Muise, S., Farazifard, R., Haque, M. E., i wsp. (2012). Mitochondrial processing peptidase regulates PINK1 processing, import and Parkin recruitment. EMBO Rep. 13, 378–385. doi:10.1038/embor.2012.14. 
Grima, B., Lamouroux, A., Chplot, E., Papin, C., Limbourg-Bouchon, B., i Rouyer, F. (2002). The F-box protein Slimb controls the levels of clock proteins Period and Timeless. Nature 420, 178–182. doi:10.1038/nature01122. 
Guo, L., Xiong, H., Kim, J.-I., Wu, Y.-W., Lalchandani, R. R., Cui, Y., i wsp. (2015). Dynamic rewiring of neural circuits in the motor cortex in mouse models of Parkinson’s disease. Nat. Neurosci. 18, 1299–1309. doi:10.1038/nn.4082. 
Harder, Z., Zunino, R., i McBride, H. (2004). Sumo1 conjugates mitochondrial substrates and participates in mitochondrial fission. Curr. Biol. 14, 340–345. doi:10.1016/S09609822(04)00084-3. 
Hardin, P. E. (2005). The Circadian Timekeeping System of Drosophila. Curr. Biol. 15, R714–R722. doi:10.1016/j.cub.2005.08.019. 
Hardin, P. E., Hall, J. C., i Rosbash, M. (1990). Feedback of the Drosophila period gene product on circadian cycling of its messenger RNA levels. Nature 343, 536–540. doi:10.1038/343536a0. 
Helfrich-Förster, C. (1998). Robust circadian rhythmicity of Drosophila melanogaster requires the presence of lateral neurons: a brain-behavioral study of disconnected mutants. J. Comp. Physiol. A Sensory, Neural, Behav. Physiol. 182, 435–453. doi:10.1007/s003590050192. 
Henchcliffe, C., i Beal, M. F. (2008). Mitochondrial biology and oxidative stress in Parkinson disease pathogenesis. Nat. Clin. Pract. Neurol. 4, 600–609. doi:10.1038/ncpneuro0924. 
Hughes, J. R. (1958). Post-Tetanic Potentiation. Physiol. Rev. 38, 91–113. doi:10.1152/physrev.1958.38.1.91. 
Hunter-Ensor, M., Ousley, A., i Sehgal, A. (1996). Regulation of the Drosophila protein timeless suggests a mechanism for resetting the circadian clock by light. Cell 84, 677– 
85. Available at: http://www.ncbi.nlm.nih.gov/pubmed/8625406 [Accessed December 10, 2018]. 
Julienne, H., Buhl, E., Leslie, D. S., i Hodge, J. J. L. (2017). Drosophila PINK1 and parkin loss-of-function mutants display a range of non-motor Parkinson’s disease phenotypes. Neurobiol. Dis. 104, 15–23. doi:10.1016/j.nbd.2017.04.014. 
Kamat, P. K., Kalani, A., Rai, S., Swarnkar, S., Tota, S., Nath, C., i wsp. (2016). Mechanism of Oxidative Stress and Synapse Dysfunction in the Pathogenesis of Alzheimer’s Disease: Understanding the Therapeutics Strategies. Mol. Neurobiol. 53, 648–661. doi:10.1007/s12035-014-9053-6. 
Kaneko, M., Helfrich-Förster, C., i Hall, J. C. (1997). Spatial and temporal expression of the period and timeless genes in the developing nervous system of Drosophila: newly identified pacemaker candidates and novel features of clock gene product cycling. J. Neurosci. 17, 6745–60. Available at: http://www.ncbi.nlm.nih.gov/pubmed/9254686 [Accessed December 10, 2018]. 
Kim, S. T., Ahn, S.-Y., Swat, W., i Miner, J. H. (2014). DLG1 influences distal ureter maturation via a non-epithelial cell autonomous mechanism involving reduced retinoic acid signaling, Ret expression, and apoptosis. Dev. Biol. 390, 160–9. doi:10.1016/j.ydbio.2014.03.014. 
Kim, Y. S., i Joh, T. H. (2006). Microglia, major player in the brain inflammation: their roles in the pathogenesis of Parkinson’s disease. Exp. Mol. Med. 38, 333–347. doi:10.1038/emm.2006.40. 
Kitada, T., Asakawa, S., Hattori, N., Matsumine, H., Yamamura, Y., Minoshima, S., i wsp. (1998). Mutations in the parkin gene cause autosomal recessive juvenile parkinsonism. Nature 392, 605–608. doi:10.1038/33416. 
Kloss, B., Price, J. L., Saez, L., Blau, J., Rothenfluh, A., Wesley, C. S., i wsp. (1998). The Drosophila clock gene double-time encodes a protein closely related to human casein kinase Iepsilon. Cell 94, 97–107. Available at: http://www.ncbi.nlm.nih.gov/pubmed/9674431 [Accessed May 15, 2018]. 
Kreitzer, A. C., i Malenka, R. C. (2007). Endocannabinoid-mediated rescue of striatal LTD and motor deficits in Parkinson’s disease models. Nature 445, 643–647. 
doi:10.1038/nature05506. 

Lai, Y., Lou, X., Diao, J., i Shin, Y.-K. (2015). Molecular origins of synaptotagmin 1 activities on vesicle docking and fusion pore opening. Sci. Rep. 5, 9267. doi:10.1038/srep09267. 
Lee, C., Bae, K., i Edery, I. (1999). PER and TIM inhibit the DNA binding activity of a Drosophila CLOCK-CYC/dBMAL1 heterodimer without disrupting formation of the heterodimer: a basis for circadian transcription. Mol. Cell. Biol. 19, 5316–25. Available at: http://www.ncbi.nlm.nih.gov/pubmed/10409723 [Accessed December 10, 2018]. 
Lee, I. C., Ho, X. Y., George, S. E., Goh, C. W., Sundaram, J. R., Pang, K. K. L., i wsp. (2018). Oxidative stress promotes SIRT1 recruitment to the GADD34/PP1α complex to activate its deacetylase function. Cell Death Differ. 25, 255–267. doi:10.1038/cdd.2017.152. 
Li, D.-Y., Yu, J.-C., Xiao, L., Miao, W., Ji, K., Wang, S.-C., i wsp. (2017a). Autophagy attenuates the oxidative stress-induced apoptosis of Mc3T3-E1 osteoblasts. Eur. Rev. Med. Pharmacol. Sci. 21, 5548–5556. Available at: http://www.ncbi.nlm.nih.gov/pubmed/29271985 [Accessed May 15, 2018]. 
Li, D.-Y., Yu, J.-C., Xiao, L., Miao, W., Ji, K., Wang, S.-C., i wsp. (2017b). Autophagy attenuates the oxidative stress-induced apoptosis of Mc3T3-E1 osteoblasts. Eur. Rev. Med. Pharmacol. Sci. 21, 5548–5556. Available at: http://www.ncbi.nlm.nih.gov/pubmed/29271985 [Accessed September 12, 2018]. 
Li, S., Wang, Y., Wang, F., Hu, L.-F., i Liu, C.-F. (2017c). A New Perspective for Parkinson’s Disease: Circadian Rhythm. Neurosci. Bull. 33, 62–72. doi:10.1007/s12264016-0089-7. 
Lin, J.-M., Kilman, V. L., Keegan, K., Paddock, B., Emery-Le, M., Rosbash, M., i wsp. (2002). A role for casein kinase 2α in the Drosophila circadian clock. Nature 420, 816– 
820. doi:10.1038/nature01235. 

Liu, R., Guo, X., Park, Y., Huang, X., Sinha, R., Freedman, N. D., i wsp. (2012). Caffeine Intake, Smoking, and Risk of Parkinson Disease in Men and Women. Am. J. Epidemiol. 175, 1200–1207. doi:10.1093/aje/kwr451. 
Liu, W., Acín-Perpz, R., Geghman, K. D., Manfredi, G., Lu, B., i Li, C. (2011). Pink1 regulates the oxidative phosphorylation machinery via mitochondrial fission. Proc. Natl. Acad. Sci. U. S. A. 108, 12920–4. doi:10.1073/pnas.1107332108. 
Logroscino, G. (2005). The Role of Early Life Environmental Risk Factors in Parkinson Disease: What Is the Evidence? Environ. Health Perspect. 113, 1234–1238. 
doi:10.1289/ehp.7573. 

Lokireddy, S., Wijesoma, I. W., Teng, S., Bonala, S., Gluckman, P. D., McFarlane, C., i wsp. (2012). RETRACTED: The Ubiquitin Ligase Mul1 Induces Mitophagy in Skeletal Muscle in Response to Muscle-Wasting Stimuli. Cell Metab. 16, 613–624. doi:10.1016/j.cmet.2012.10.005. 
Marcelli, S., Ficulle, E., Piccolo, L., Corbo, M., i Feligioni, M. (2018). An overview of the possible therapeutic role of SUMOylation in the treatment of Alzheimer’s disease. Pharmacol. Res. 130, 420–437. doi:10.1016/j.phrs.2017.12.023. 
Matsuda, N., Sato, S., Shiba, K., Okatsu, K., Saisho, K., Gautier, C. A., i wsp. (2010). PINK1 stabilized by mitochondrial depolarization recruits Parkin to damaged mitochondria and activates latent Parkin for mitophagy. J. Cell Biol. 189, 211–221. doi:10.1083/jcb.200910140. 
Matus, S., Lisbona, F., Torres, M., León, C., Thielen, P., i Hetz, C. (2008). The stress rheostat: an interplay between the unfolded protein response (UPR) and autophagy in neurodegeneration. Curr. Mol. Med. 8, 157–72. Available at: http://www.ncbi.nlm.nih.gov/pubmed/18473817 [Accessed December 6, 2018]. 
Milton, V. J., i Sweeney, S. T. (2012). Oxidative stress in synapse development and function. Dev. Neurobiol. 72, 100–110. doi:10.1002/dneu.20957. 
Mistlberger, R. E. (2005). Circadian regulation of sleep in mammals: Role of the suprachiasmatic nucleus. Brain Res. Rev. 49, 429–454. doi:10.1016/j.brainresrev.2005.01.005. 
Molina-Luna, K., Pekanovic, A., Röhrich, S., Hertler, B., Schubring-Giese, M., Rioult-Pedotti, M.-S., i wsp. (2009). Dopamine in Motor Cortex Is Necessary for Skill Learning and Synaptic Plasticity. PLoS One 4, e7082. doi:10.1371/journal.pone.0007082. 
Myers, M. P., Wager-Smith, K., Rothenfluh-Hilfiker, A., i Young, M. W. (1996a). Lightinduced degradation of TIMELESS and entrainment of the Drosophila circadian clock. Science 271, 1736–40. Available at: http://www.ncbi.nlm.nih.gov/pubmed/8596937 [Accessed September 20, 2018]. 
Myers, M. P., Wager-Smith, K., Rothenfluh-Hilfiker, A., i Young, M. W. (1996b). Lightinduced degradation of TIMELESS and entrainment of the Drosophila circadian clock. Science 271, 1736–40. Available at: http://www.ncbi.nlm.nih.gov/pubmed/8596937 [Accessed December 6, 2018]. 
Nishijima, H., Suzuki, S., Kon, T., Funamizu, Y., Ueno, T., Haga, R., i wsp. (2014). Morphologic changes of dendritic spines of striatal neurons in the levodopa-induced 
dyskinesia model. Mov. Disord. 29, 336–343. doi:10.1002/mds.25826. 
Ordureau, A., Sarraf, S. A., Duda, D. M., Heo, J.-M., Jedrychowski, M. P., Sviderskiy, V. O., i wsp. (2014). Quantitative Proteomics Reveal a Feedforward Mechanism for Mitochondrial PARKIN Translocation and Ubiquitin Chain Synthesis. Mol. Cell 56, 360–375. doi:10.1016/j.molcel.2014.09.007. 
Özkaya, Ö., i Rosato, E. (2012). The Circadian Clock of the Fly: A Neurogenetics Journey Through Time. doi:10.1016/B978-0-12-387687-4.00004-0. 
Pankiv, S., Clausen, T. H., Lamark, T., Brech, A., Bruun, J.-A., Outzen, H., i wsp. (2007). p62/SQSTM1 Binds Directly to Atg8/LC3 to Facilitate Degradation of Ubiquitinated Protein Aggregates by Autophagy. J. Biol. Chem. 282, 24131–24145. doi:10.1074/jbc.M702824200. 
Parisky, K. M., Agosto, J., Pulver, S. R., Shang, Y., Kuklin, E., Hodge, J. J. L., i wsp. (2008). PDF Cells Are a GABA-Responsive Wake-Promoting Component of the Drosophila Sleep Circuit. Neuron 60, 672–682. doi:10.1016/J.NEURON.2008.10.042. 
Park, J., Lee, S. B., Lee, S. B., Kim, Y., Song, S., Kim, S., i wsp. (2006a). Mitochondrial dysfunction in Drosophila PINK1 mutants is complemented by parkin. Nature 441, 1157–1161. doi:10.1038/nature04788. 
Park, J., Lee, S. B., Lee, S., Kim, Y., Song, S., Kim, S., i wsp. (2006b). Mitochondrial dysfunction in Drosophila PINK1 mutants is complemented by parkin. Nature 441, 1157–1161. doi:10.1038/nature04788. 
Park, J., Lee, S. B., Lee, S., Kim, Y., Song, S., Kim, S., i wsp. (2006c). Mitochondrial dysfunction in Drosophila PINK1 mutants is complemented by parkin. Nature 441, 1157–1161. doi:10.1038/nature04788. 
Parkinson, J. (2002). An Essay on the Shaking Palsy. J. Neuropsychiatry Clin. Neurosci. 14, 223–236. doi:10.1176/jnp.14.2.223. 
Picconi, B., Centonze, D., Häkansson, K., Bernardi, G., Greengard, P., Fisone, G., i wsp. (2003). Loss of bidirectional striatal synaptic plasticity in L-DOPA–induced dyskinesia. Nat. Neurosci. 6, 501–506. doi:10.1038/nn1040. 
Renn, S. C., Park, J. H., Rosbash, M., Hall, J. C., i Taghert, P. H. (1999). A pdf neuropeptide gene mutation and ablation of PDF neurons each cause severe abnormalities of behavioral circadian rhythms in Drosophila. Cell 99, 791–802. Available at: http://www.ncbi.nlm.nih.gov/pubmed/10619432 [Accessed December 10, 2018]. 
Rizek, P., Kumar, N., i Jog, M. S. (2016). An update on the diagnosis and treatment of Parkinson disease. CMAJ 188, 1157–1165. doi:10.1503/cmaj.151179. 
Rosińczuk, J., Dymarek, R., i Całkosiński, I. (2018). The protective action of tocopherol and acetylsalicylic acid on the behavior of rats treated with dioxins. Adv. Clin. Exp. Med. 27, 5–14. Available at: http://www.ncbi.nlm.nih.gov/pubmed/29521038 [Accessed September 12, 2018]. 
Sampedro-Piquero, P., Arias, J. L., i Begega, A. (2014). Behavioral testing-related changes in the expression of Synapsin I and glucocorticoid receptors in standard and enriched aged Wistar rats. Exp. Gerontol. 58, 292–302. doi:10.1016/j.exger.2014.09.004. 
Sang, T.-K., Chang, H.-Y., Lawless, G. M., Ratnaparkhi, A., Mee, L., Ackerson, L. C., i wsp. (2007). A Drosophila Model of Mutant Human Parkin-Induced Toxicity Demonstrates Selective Loss of Dopaminergic Neurons and Dependence on Cellular Dopamine. J. Neurosci. 27, 981–992. doi:10.1523/JNEUROSCI.4810-06.2007. 
Santiago, R. M., Barbiero, J., Gradowski, R. W., Bochen, S., Lima, M. M. S., Da Cunha, C., i wsp. (2014). Induction of depressive-like behavior by intranigral 6-OHDA is directly correlated with deficits in striatal dopamine and hippocampal serotonin. Behav. Brain Res. 259, 70–77. doi:10.1016/j.bbr.2013.10.035. 
Schrag, A., Horsfall, L., Walters, K., Noyce, A., i Petersen, I. (2015). Prediagnostic presentations of Parkinson’s disease in primary care: a case-control study. Lancet Neurol. 14, 57–64. doi:10.1016/S1474-4422(14)70287-X. 
Shen, W., Flajolet, M., Greengard, P., i Surmeier, D. J. (2008). Dichotomous Dopaminergic Control of Striatal Synaptic Plasticity. Science (80-. ). 321, 848–851. doi:10.1126/science.1160575. 
Shen, W., i Ganetzky, B. (2009). Autophagy promotes synapse development in Drosophila. J. Cell Biol. 187, 71–79. doi:10.1083/jcb.200907109. 
Singleton, A. B., Farrer, M. J., i Bonifati, V. (2013). The genetics of Parkinson’s disease: Progress and therapeutic implications. Mov. Disord. 28, 14–23. doi:10.1002/mds.25249. 
Siwicki, K. K., Eastman, C., Petersen, G., Rosbash, M., i Hall, J. C. (1988a). Antibodies to the period gene product of Drosophila reveal diverse tissue distribution and rhythmic changes in the visual system. Neuron 1, 141–50. Available at: http://www.ncbi.nlm.nih.gov/pubmed/3152288 [Accessed December 6, 2018]. 
Siwicki, K. K., Eastman, C., Petersen, G., Rosbash, M., i Hall, J. C. (1988b). Antibodies to the period gene product of Drosophila reveal diverse tissue distribution and rhythmic changes in the visual system. Neuron 1, 141–50. Available at: http://www.ncbi.nlm.nih.gov/pubmed/3152288 [Accessed September 20, 2018]. 
Smit, J. J., Monteferrario, D., Noordermeer, S. M., van Dijk, W. J., van der Reijden, B. A., 
and Sixma, T. K. (2012). The E3 ligase HOIP specifies linear ubiquitin chain assembly through its RING-IBR-RING domain and the unique LDD extension. EMBO J. 31, 3833–3844. doi:10.1038/emboj.2012.217. 
Smith, E. S., Geissler, S. A., Schallert, T., i Lee, H. J. (2013). The role of central amygdala dopamine in disengagement behavior. Behav. Neurosci. 127, 164–174. doi:10.1037/a0031043. 
Spatola, M., i Wider, C. (2014). Genetics of Parkinson’s disease: the yield. Parkinsonism Relat. Disord. 20, S35–S38. doi:10.1016/S1353-8020(13)70011-7. 
Suppa, A., Marsili, L., Belvisi, D., Conte, A., Iezzi, E., Modugno, N., i wsp. (2011). Lack of LTP-like plasticity in primary motor cortex in Parkinson’s disease. Exp. Neurol. 227, 296–301. doi:10.1016/j.expneurol.2010.11.020. 
Suzuki, K., Okuma, Y., Uchiyama, T., Miyamoto, M., Sakakibara, R., Shimo, Y., i wsp. (2017). Impact of sleep-related symptoms on clinical motor subtypes and disability in Parkinson’s disease: a multicentre cross-sectional study. J. Neurol. Neurosurg. Psychiatry 88, 953–959. doi:10.1136/jnnp-2017-316136. 
Tahara, Y., i Shibata, S. (2018). Entrainment of the mouse circadian clock: Effects of stress, exercise, and nutrition. Free Radic. Biol. Med. 119, 129–138. doi:10.1016/j.freeradbiomed.2017.12.026. 
Talpade, D. J., Greene, J. G., Higgins, D. S., i Greenamyre, J. T. (2008). In Vivo Labeling of Mitochondrial Complex I (NADH:UbiquinoneOxidoreductase) in Rat Brain Using [3H]Dihydrorotenone. J. Neurochem. 75, 2611–2621. doi:10.1046/j.14714159.2000.0752611.x. 
Tamaru, T., Hattori, M., Ninomiya, Y., Kawamura, G., Varqs, G., Honda, K., i wsp. (2013). ROS Stress Resets Circadian Clocks to Coordinate Pro-Survival Signals. PLoS One 8, e82006. doi:10.1371/journal.pone.0082006. 
Thomas, R. E., Andrews, L. A., Burman, J. L., Lin, W. Y., i Pallanck, L. J. (2014). PINK1Parkin Pathway Activity Is Regulated by Degradation of PINK1 in the Mitochondrial Matrix. PLoS Genet. 10. doi:10.1371/journal.pgen.1004279. 
Tong, J., Qin, L. Q., i Wang, D. J. (2000). [Mechanism of pineal and suprachiasmatic regulation on circadian rhythm of body temperature in rats]. Space Med. Med. Eng. (Beijing). 13, 101–3. Available at: http://www.ncbi.nlm.nih.gov/pubmed/11543047 [Accessed May 15, 2018]. 
Trempe, J.-F., i Fon, E. A. (2013). Structure and Function of Parkin, PINK1, and DJ-1, the Three Musketeers of Neuroprotection. Front. Neurol. 4, 38. 
doi:10.3389/fneur.2013.00038. 

Twelves, D., Perkins, K. S. M., i Counsell, C. (2003). Systematic review of incidence studies of Parkinson’s disease. Mov. Disord. 18, 19–31. doi:10.1002/mds.10305. 
Ueki, Y., Mima, T., Ali Kotb, M., Sawada, H., Saiki, H., Ikeda, A., i wsp. (2006). Altered plasticity of the human motor cortex in Parkinson’s disease. Ann. Neurol. 59, 60–71. doi:10.1002/ana.20692. 
Vasin, A., Zueva, L., Torrez, C., Volfson, D., Littleton, J. T., i Bykhovskaia, M. (2014). Synapsin Regulates Activity-Dependent Outgrowth of Synaptic Boutons at the Drosophila Neuromuscular Junction. J. Neurosci. 34, 10554–10563. doi:10.1523/JNEUROSCI.5074-13.2014. 
Vosshall, L. B., Price, J. L., Sehgal, A., Saez, L., i Young, M. W. (1994). Block in nuclear localization of period protein by a second clock mutation, timeless. Science 263, 1606–9. Available at: http://www.ncbi.nlm.nih.gov/pubmed/8128247 [Accessed December 10, 2018]. 
Wagh, D. A., Rasse, T. M., Asan, E., Hofbauer, A., Schwenkert, I., Dürrbeck, H., i wsp. (2006). Bruchpilot, a protein with homology to ELKS/CAST, is required for structural integrity and function of synaptic active zones in Drosophila. Neuron 49, 833–844. doi:10.1016/j.neuron.2006.02.008. 
Wen, J.-K., Wang, Y.-T., Chan, C.-C., Hsieh, C.-W., Liao, H.-M., Hung, C.-C., i wsp. (2017). Atg9 antagonizes TOR signaling to regulate intestinal cell growth and epithelial homeostasis in Drosophila. Elife 6. doi:10.7554/eLife.29338. 
Wenzel, D. M., Lissounov, A., Brzovic, P. S., i Klevit, R. E. (2011). UBCH7 reactivity profile reveals parkin and HHARI to be RING/HECT hybrids. Nature 474, 105–108. doi:10.1038/nature09966. 
Whitton, P. S. (2009). Inflammation as a causative factor in the aetiology of Parkinson’s disease. Br. J. Pharmacol. 150, 963–976. doi:10.1038/sj.bjp.0707167. 
Wichmann, C., i Sigrist, S. J. (2010). The Active Zone T-Bar—A Plasticity Module? J. Neurogenet. 24, 133–145. doi:10.3109/01677063.2010.489626. 
Winklhofer, K. F. (2014). Parkin and mitochondrial quality control: toward assembling the puzzle. Trends Cell Biol. 24, 332–341. doi:10.1016/j.tcb.2014.01.001. 
Xu, D., Woodfield, S. E., Lee, T. V., Fan, Y., Antonio, C., i Bergmann, A. (2009). Genetic control of programmed cell death (apoptosis) in Drosophila. Fly (Austin). 3, 78–90. doi:10.4161/fly.3.1.7800. 
Yamano, K., i Youle, R. J. (2013). PINK1 is degraded through the N-end rule pathway. 
Autophagy 9, 1758–1769. doi:10.4161/auto.24633. 
Yang, Y., Gehrke, S., Imai, Y., Huang, Z., Ouyang, Y., Wang, J.-W., i wsp. (2006). Mitochondrial pathology and muscle and dopaminergic neuron degeneration caused by inactivation of Drosophila Pink1 is rescued by Parkin. Proc. Natl. Acad. Sci. U. S. A. 103, 10793–10798. doi:10.1073/pnas.0602493103. 
Yasuda, T., i Mochizuki, H. (2010). The regulatory role of α-synuclein and parkin in neuronal cell apoptosis; possible implications for the pathogenesis of Parkinson’s disease. Apoptosis 15, 1312–1321. doi:10.1007/s10495-010-0486-8. 
Yu, W., Zheng, H., Houl, J. H., Dauwalder, B., i Hardin, P. E. (2006). PER-dependent rhythms in CLK phosphorylation and E-box binding regulate circadian transcription. Genes Dev. 20, 723–733. doi:10.1101/gad.1404406. 
Yu, Y., Dong, W., Altimus, C., Tang, X., Griffith, J., Morello, M., i wsp. (2007). A genetic network for the clock of Neurospora crassa. Proc. Natl. Acad. Sci. 104, 2809–2814. doi:10.1073/pnas.0611005104. 
Yun, J., Puri, R., Yang, H., Lizzio, M. A., Wu, C., Sheng, Z.-H., i wsp. (2014). MUL1 acts in parallel to the PINK1/parkin pathway in regulating mitofusin and compensates for loss of PINK1/parkin. Elife 3, e01958. Available at: http://www.ncbi.nlm.nih.gov/pubmed/24898855 [Accessed May 15, 2018]. 
Zeng, H., Hardin, P. E., i Rosbash, M. (1994). Constitutive overexpression of the Drosophila period protein inhibits period mRNA cycling. EMBO J. 13, 3590–8. Available at: http://www.ncbi.nlm.nih.gov/pubmed/8062834 [Accessed December 10, 2018]. 
Zeng, H., Qian, Z., Myers, M. P., i Rosbash, M. (1996). A light-entrainment mechanism for the Drosophila circadian clock. Nature 380, 129–135. doi:10.1038/380129a0. 
Zerr, D. M., Hall, J. C., Rosbash, M., i Siwicki, K. K. (1990a). Circadian fluctuations of period protein immunoreactivity in the CNS and the visual system of Drosophila. J. Neurosci. 10, 2749–62. Available at: http://www.ncbi.nlm.nih.gov/pubmed/2117644 [Accessed December 6, 2018]. 
Zerr, D. M., Hall, J. C., Rosbash, M., i Siwicki, K. K. (1990b). Circadian fluctuations of period protein immunoreactivity in the CNS and the visual system of Drosophila. J. Neurosci. 10, 2749–62. Available at: http://www.ncbi.nlm.nih.gov/pubmed/2117644 [Accessed September 20, 2018]. 
Zhou, C., Huang, Y., i Przedborski, S. (2008). Oxidative Stress in Parkinson’s Disease. Ann. 
N. Y. Acad. Sci. 1147, 93–104. doi:10.1196/annals.1427.023. Zhou, L., Bryant, C. D., Loudon, A., Palmer, A. A., Vitaterna, M. H., i Turek, F. W. (2014). 
The Circadian Clock Gene Csnk1e Regulates Rapid Eye Movement Sleep Amount, and Nonrapid Eye Movement Sleep Architecture in Mice. Sleep 37, 785–793. doi:10.5665/sleep.3590. 
BMC Neuroscience 

EffecvufhoffgOUN1fhandfgPARKINfhonfgvhefgcircadianfh clock,fhbrainfhandfgbehaviourfhinfgl fh Parkinuon’ufhdiueauefhmodelu 
Bartosz Dokt ór, Milena Damulewicz and Elżbieta Pyza* 
t 
We found that the ROS level was higher, while the anti-oxidant enzyme SOD1 level was lower in and  mutants than in the  mutant used as a control. Moreover, mutations of both ligases affected circadian rhythms and the clock. The expression of clock genes ,  and  and the level of PER protein were changed in the mutants. Moreover, expression of ATG5, an autophagy protein also involved in circadian rhythm regulation, was decreased in the brain and in PDF-immunoreactive large ventral lateral clock neurons. The observed changes in the molecular clock resulted in a longer period of locomotor activity rhythm, increased total activity and shorter sleep at night. Finally, the lack of both ligases led to decreased longevity and climbing ability of the flies. 
All of the changes observed in the brains of these  models of PD, in which mitochondrial ligases MUL1 and PARKIN do not function, may explain the mechanisms of some neurological and behavioural symptoms of PD. 
Mitochondrial ligases, Clock genes, Clock neurons, ROS, SOD1, Autophagy, Locomotor activity rhythm, Sleep 
p 
Mitochondria are important organelles in the metabolism of all cells, particularly in neurons because of their high energy demand [1]. As a result, several neurodegenerative diseases in which changes in mitochondrial structure and function lead to cell death [2]. One of these diseases is Parkinson’s disease (PD), which can be caused by exposure to neurotoxins and/or by several gene mutations. These mutations include mutations in genes encoding PINK1, a mitochondrial kinase, and PARKIN, an E3 ubiquitin ligase, which leads to the autosomal recessive form of PD [3, 4]. These proteins regulate the function and morphology of mitochondria and 
*Correspondence:  elzbieta.pyza@uj.edu.pl Department of Cell Biology and Imaging, Institute of Zoology and Biomedical Research, Jagiellonian University, Krak w, Poland 
promote mitophagy [5, 6]. Dysfunctional and damaged mitochondria lose their membrane potential, leading to activation and accumulation of PARKIN and degradation of the whole organelle [7, 8]. In addition, there is another pathway that promotes mitophagy that acts in parallel to PINK1/PARKIN. This pathway involves mitochondrial ubiquitin ligase 1 (MUL1), which is responsible for mitochondrial integrity, fusion–fission processes, mitophagy and SUMOylation. Mutations in  lead to typical PD symptoms, similar to those observed in / mutants [9]. In addition to molecular symptoms such as those observerd in  and  mutants, Parkinson’s disease are also characterized by other motor and nonmotor symptoms. Main motor disorders are bradykinesia and tremor, while non-motor disorders include pain, cognitive deficits, depression and sleep problems due to restless legs syndrome, REM sleep behaviour disorder (RBD 

… The Author(s) 2019. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/ <BR>publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. 
and excessive daytime sleepiness (EDS) or insomnia [10]. Sleep fragmentation and reduced sleep efficiency have an impact on patient quality of life and may accelerate the development of PD. Non-motor symptoms have also been observed in circadian rhythms of core body temperature and blood pressure. Because the circadian clock controls many of the abovementioned processes [11–13], the non-motor symptoms of PD might be a consequence of circadian clock malfunction and not a direct cause of the disease. 
The central clock (pacemaker is composed of 150 neurons in the brain. These neurons are grouped into several clusters: large ventral lateral neurons (l-LNvs, small ventral lateral neurons (s-LNvs, lateral dorsal neurons (LNds), dorsal neurons (DN1-DN3 and posterior lateral neurons (LPNs [14]. All l-LNvs and four of the five s-LNs are immunoreactive to pigmentdispersing factor (PDF , a main neurotransmitter of the clock. The molecular mechanism of the fruit fly clock is based on the cyclic expression of several clock genes and their proteins. The core clock genes include , ) and ) [15].  and expression is activated at the end of the day and at the beginning of the night by CLK/CYC transcription factors, acting as heterodimers. PER and TIM are synthesized at the end of the night, form heterodimers and, by entering the nucleus, inhibit the activity of CLK and CYC and the transcription of their own genes. This negative feedback loop is the main mechanism of the clock.
In the present study, we examined whether mutations of  and  genes affect the molecular mechanism of the circadian clock and clock neurons, which may lead to changes in behavioural circadian rhythms and sleep disturbance. We studied whether both mutations affect cell protective mechanisms, synthesis of antioxidant proteins and autophagy. To evaluate the phenotypes associated with  and  mutants, we also examined the longevity of the flies. We used 
 since similar mechanisms and phenotypes of some human diseases have been described in this species [5, 6]. In addition,  is a primary model used in neuroscience and the study of circadian rhythms and clocks. 
t u 
The following strains were used for the experiments: 
 (null mutation of the  gene encoding the mitochondrial ligase PARKIN, Bloomington Drosophila Stock Centre) [16],  (null mutation of the gene encoding the mitochondrial ligase MUL1, kindly donated by Dr. Ming Guo, Brain Research Institute, USA) 


[9] and  (null mutation of the  gene encoding ABC transporter, Bloomington Drosophila Stock Cen-tre, which was used as controls because of the genetic background of mutants  and ) [17]. Flies were maintained on standard yeast-cornmeal-agar medium at 25∔1 °C under a day/night cycle, LD 12:12 
(12 h of light and 12 h of darkness. 
One- to two-day-old males (N∓32) were transferred to small glass tubes containing sugar-agar food medium. Vials were placed in DAMS monitors (Drosophila Activ-ity Monitoring System, TriKinetics) and inside an incubator (25ι °C ). Monitors were equipped with infrared sensors that recorded the activity of the flies inside the vials every 5 min. For the first 5 days, monitors were held in LD 12:12 conditions, followed by constant darkness 
(DD) for the next 6 days. The results from the second day of locomotor activity recording were analysed to estimate the total activity and duration of sleep during the day and during the night (Microsoft Excel plugin, BeFly kindly donated by Dr. E. Green, University of Leicester, [18] and Python 22 http://www.python.org/ <BR>). Sleep in flies was defined as the time in which they did not change their position for at least 5 min. The experiment was repeated three times. In LD 12:12 and DD, the rhythm of locomotor activity was also examined, and the period of the circadian rhythm was estimated in DD. 

Seven-day-old males were fixed at ZT1 in 4% paraformaldehyde in 0.2% PBT for 3 h at 4 °C. Isolated brains were washed six times in PBS for 5 min each time. Next, they were incubated in 5 normal goat serum (NGS and 0.5% bovine serum albumin (BSA) for 30 min at room temperature. Subsequently, brains were incubated overnight with a mouse primary antibody targeting PDF (1:1000, Developmental Studies Hybridoma Bank) or a rabbit antibody targeting ATG5, an autophagy protein (1:500, Abcam). Afterwards, brains were washed six times in 0.2% PBT for 5 min each time and incubated overnight at 4 °C with secondary goat anti-mouse Cy3-conjugated 
(1:500, Jackson ImmunoResearch) or goat anti-rabbit Alexa 488-conjugated (1:1000, MolecularProbes) anti-bodies, depending on the primary antibodies. Finally, brains were washed four times in 0.2 PBT and twice in PBS and mounted in Vectashield medium (Additional file 1: Table S1. 

To measure the fluorescence intensity of ATG5 protein in the large ventral lateral neurons (l-LNvs), we used confocal microscopy. We identified cell bodies of l-LNvs using the anti-PDF antibody, and we scanned the same cell for 
Dokvórfg l u 
labelling with the anti-ATG5 antibody. We selected all l-LNv cell bodies and measured the fluorescence intensity of the ATG5 protein. Images were collected with a Zeiss Meta 510 Laser Scanning Microscope (Additional file 2: Table S2. 

To measure whether ROS levels were increased in and  mutants, 7-day-old males (N∓10) of mutants and controls were decapitated at ZT0. Brains were isolated and washed twice in PBS for 10 min. Next, the tissue was incubated with MitoSOX ThermoFisher) for 10ι min and mounted in Vectashield medium. Images were collected with a Zeiss Meta 510 Laser Scanning Microscope. The method has been described by Scialò et al. [19]. 

Seven-day-old males (N∓30) were frozen in liquid nitrogen at four time points (ZT1, ZT4, ZT13, ZT16) and decapitated. Heads were homogenized by sonication in 30 µl of Laemmli buffer with a protease inhibitor (Boehringer, Mannheim, left for 30 min at 4 °C and frozen at −20ι °C. Homogenates were centrifuged at 13,200 rpm for 1 h at 4 °C. Supernatants were collected and denatured at 85ι °C for 5ι min. Total protein levels were measured using a Quant-iT Protein Assay Kit and Qubit fluorometer (Invitrogen). Afterwards, 20ι µg of protein from each supernatant was subjected to electrophoresis (NuPAGE 4–12 bis–Tris gels, Invitrogen) at 165 V for 40 min and then blotted by electrotransfer onto a PVDF membrane (Invitrogen at 30 V for 60 min. The membrane was blocked in 5% non-fat dry milk in PBS with 0.1% Tween 20 TBS) for 1 h at 4 °C and incubated with a mix of primary antibodies: anti-ATG5 (1:1000), anti-PER (1:10,000, kindly donated by Dr. Ralph Stanewsky, University of Münster, Germany) or antiSOD1 (1:5000, Abgent) and anti-α tubulin (1:20,000, Developmental Studies Hybridoma Bank) in 1% BSA in 0.1% TBS overnight at 4ι °C. Next, the membrane was washed 5 times in 0.1% TBS for 10 min each time and incubated with secondary antibodies conjugated to HRP 
(1: 10,000, Abcam) in 0.1% TBS with 1% BSA for 1 h at room temperature. After incubation, the membrane was washed 5 times in 0.1% TBS and immunodetected with an ECL detection system (Perkin Elmer). Densitometric analysis of Western blot was performed using ImageJ. The experiment was repeated three times (Additional file 3: Table S3. 

Seven-day-old males (N∓20) were decapitated at ZT1, ZT4, ZT13 or ZT16 in LD 12:12. Heads were fixed in 
100% ethanol for 2h, and brains were isolated. Total RNA was isolated using TriReagent (MRC Inc.). Total RNA (5 μg) was used for reverse transcription [High-Capac-ity cDNA Reverse Transcription Kit ThermoFisher)] according to the manufacturer’s protocol. A total of 1000 ng cDNA diluted 1:10) was used for quantitative PCR. Each experiment was repeated three times. The expression of the following clock genes  and  was examined using TaqMan ThermoFisher. (Dm01843683,  (Dm01814242  (Dm01795381 and reference gene  (Dm02151827) probes were also obtained from ThermoFisher. The reaction was per-formed using the StepOnePlus Real-Time PCR System 
ThermoFisher). Data were collected as raw CT values and analysed using the 2−ΔΔCT method. Gene expression was normalized on an arbitrary scale normalized to control (Additional file4: Table S4).
One-day-old males of each strain were placed into vials containing the standard food medium (20 flies per vial). Every 3–4 days, flies were transferred to new vials with fresh food, and the number of dead flies was counted. The experiment was repeated three times. 

The statistical analyses were performed using GraphPad Prism 6. Normal distribution of data was examined, and statistical tests were chosen accordingly. For lifespan analysis, the Kaplan–Meier test was used. The Wilcoxon–Mann–Whitney and Kruskal–Wallis tests were performed to assess differences in sleep and total activity. The results obtained from analysis of period of the circadian rhythm of locomotor activity, climbing assay, Western Blot, qPCR, ROS measurements and the fluorescent intensity associated with ATG5 level were analysed using one-way ANOVA and Tukey’s test. 
u 
mul1parkThe lifespan analysis of  and  mutants showed that both mutations significantly reduced longevity up to 30% and 25% in  and , respectively 
(Fig. 1a.  and  flies had longer total activity times during 24 h (LD 12:12) (Fig. 1b) than controls. Although the total activity was increased, the daytime sleep duration was the same across genotypes. However, the sleep duration during the night was decreased only in  mutants compared to that in control. Moreover, the period of locomotor activity rhythm was lengthened to ~27 h in  mutants and ~25 h in  mutants, 

1 Effects of  and  mutations on lifespan and the circadian rhythm of locomotor activity.  Kaplan–Meier survival curve. Dead flies were counted every3 days. Statistically significant differences were detected between  control and  (p<0.05), and also between and  mutants (p<0.05). N of ∓231, N of ∓150, N of ∓233. Total activity and sleep duration during the day and at night in 
∓25, 

LD 12:12. The Y-axis shows time in minutes when flies were active or their sleep time (means ∔SD) (four asterisks indicates p<0.01). N of N of ∓29, N of ∓21.  Period of locomotor activity rhythm in all studied genotypes (means ∔SD). Statistically significant differences were detected between  control and  (p<0.05), and also between  and  mutants (p < 0.05). N of ∓31, N of ∓47, N of ∓45 
in contrast to the approximately 24-h period in mutants, which was statistically significant (Fig. 1c . 
mul1park
Examination of clock gene expression showed that and  mutations disrupted their normal expression during the day. In both  and  mutants, the morning (ZT1 peak of expression in the brain was broader than that in the  control flies (Fig. 2a). The peak of  mRNA expression in  mutants was at ZT16, while in the  control, the peak was at ZT13, and the expression of  was around 40% higher at this time point than the expression in  mutants. The  mutants had around 35% smaller peak in mRNA expression at ZT13 than , but at ZT16, the 
 expression peak was similar to that in the control flies. Both  and  mutants had reduced mRNA levels of  at ZT13 (70% in  and 55% in . In , the maximum  expression was at ZT16, similar to peak  expression, but in  mutants, the level of  mRNA was the same at ZT13 and ZT16. The morning peak was the same in all genotypes studied (Fig.ι 2b). Daily oscillation of  was only changed in  mutants, in which the peak at ZT13 was the same as that at ZT4, and the peak at ZT16 was five times higher than that in the  controls (Fig.ι 2c ). Analysis of PER in the whole brain showed that, in  mutants, PER protein expression did not differ among the ZT1, ZT4 and ZT13 time points, but at ZT16, PER protein expression was lower than the expression in  controls, in which the highest PER abundance was observed at ZT16. The level of PER at ZT1, ZT4 and ZT13 was 20, 25 and 60% higher, respectively, then the level in  flies.  mutants showeda similar level of PER at ZT1 as control flies, but at ZT4 and ZT13, the level of PER was 50% and 65% higher, respectively. PER protein expression was at its lowest at ZT16 (Fig. 2d, e. 
mul1park
Western blot analyses showed that the level of the main endogenous antioxidant superoxide dismutase (SOD1) was reduced in and mutants by 55% and 45%, respectively, compared with the level in the control 
(Fig.ι 3a). Moreover, measurements of the fluorescence intensity associated with the free radical level in the whole  brain showed that the total ROS level was increased by 40% in both mutants (Fig. 3b. 
mul1park
Labelling of the clock neurons l-LNvs with antibodies against ATG5, an autophagy protein, and PDF, which is expressed in all l-LNvs, showed co-localization of both proteins in cell bodies of the l-LNvs (Fig.ι 4a–c . The analysis of fluorescence intensity associated with ATG5 
Dokvórfg l u 

expression in these neurons showed that in mutants, ATG5 abundance was decreased when compared with that in the control, while in  mutants, this difference was not statistically significant (Fig.ι 4d. The level of ATG5 in the whole brain in and 
 mutants was decreased by 70% and 20%, respectively, compared with that in the control (Fig. 4e). ATG5 showed expression almost everywhere in the brain, however, this signal was stronger in the l-LNvs and after the same settings of LSM it was possible to investigate the co-localization of ATG5 and PDF. 
p 
MUL1 and PARKIN proteins are responsible for mitophagy and seem to be involved in the development of Parkinson’s disease. Lack of these proteins leads to a reduced number of mitochondria and enlargement of their size [6, 9]. Our results showed that mutations in  and  increase ROS levels in the 
brain, which origin from damaged mitochondria. While low levels of ROS are typical for normal cell metabolism, their excessive amounts cause oxidative stress and damage critical components of the cell by protein and lipid oxidation [20, 21]. Moreover, both mutations contribute to the reduction of SOD1, one of the main antioxidant proteins. SOD1 reduces free radical oxygen species, and its low level leads to the accumulation of ROS and the beginning of oxidative stress [22]. We also found changes of ATG5 level. The abundance of one of the core autophagy proteins, ATG5, was decreased in and  mutants, which suggests that autophagy is inhib-ited in both mutants. The failure of autophagy machinery to efficiently remove defective proteins or damaged organelles from the cytosol, increases the level of dam-aged cellular components [23] which accumulate inside the cell. On the other hand, it has been shown that higher oxidative stress causes an increase of autophagy to remove damaged proteins that may be a source of 

oxidative stress [24, 25]. However, when intracellular stress remains unresolved, prolonged autophagy upregulation progresses into autophagy defect [26]. This finding explains why, despite of the increased ROS level, 
 and  mutants exhibited a decrease in the level of ATG5. 
As previously mentioned, patients suffering from Parkinson’s disease exhibit sleep problems and have reduced lifespan. Our findings showed that in  and models of PD, the lifespan is strongly reduced. The short lifespan may result from the reduced ATP levels. A low level of ATP was found in mutants of the gene encoding PINK1, a kinase involved in mitophagy, which acts together with PARKIN. Moreover, mitochondrial morphology defects are similar in ,  and mutants. Therefore, the level of ATP can be concluded to be reduced with mutations of genes encoding mitochondrial ligases [27]. Furthermore, the results obtained by other authors suggest that inhibition of autophagy by reducing ATG9 (another autophagy protein) levels shortens the lifespan [28], and also ATG5 protein is responsible for. In addition to the shortened life time in mutants, we also observed increased locomotor activity and sleep disorders. The results of other authors confirm our results that the  mutation increases the daily locomotor activity of  [29]. As mentioned previously, sleep is regulated by the cir-cadian clock [30, 31] and in  is controlled via PDF-positive l-LNv neurons. They regulate total sleep as well as the rate of sleep onset [32]. Thus, sleep disorders may not results directly due to autophagy disruption and/ 
or oxidative stress, but also indirectly due to circadian clock damage.
We also examined how the molecular circadian clock works in the mutant studied. The molecular mechanism of the circadian clock is based on the rhythmic expression of the core clock genes and proteins. First, we found differences in the daily expression profile of clock genes and PER protein in  and  mutants. In mutants, there was a shift of the peak of  and mRNAs to ZT16 and changes in the  gene expression rhythm. In turn, in the , mutants changes in the expression level of clock genes were observed, while the rhythms remained similar to those in the control. Despite the fact that the  gene in both mutants is rhythmically expressed, the rhythm of PER protein is completely disrupted. Between the maximum of and  mRNA levels and appearance of the maximum of their proteins is about 4 h shift (white control due to post-transcriptional processing, translation and posttranslational processes [33]. The differences between transcription and PER translation may originate from abnormal activity of translational factors. Increased levels of ROS have been reported to affect the activity of the eIF2α translation factor [34]. In turn, the increased activity of eIF2α enhances the expression of various proteins, including PER, under stress conditions. High ROS levels may also degrade SLIMB, a core protein responsible for PER degradation in proteasomes [35]. Low SLIMB activity may result in the inhibition of PER degradation, thus increasing the PER level and changing its expression profile. ROS can also “reset” the circadian clock by 
Dokvórfg l u 

modifying casein kinase 2 (CK2 [36]. CK2 phosphorylates PER and TIM and changes their levels, which may result in altered post-translational modification of PER [37]. ROS may also control the expression of clock genes. In mammals, a high level of ROS results in strong induction of clock gene expression [38]. ROS can also degrade transcription factors that regulate the expression of clock genes and proteins controlling the mRNA stability of clock proteins such as double-time kinase, NEMO kinase, VRILLE and PDP1ε [39–41]. A Shift in the transcription of clock genes between mutants and control may also be disturbed by changes in the level of other clock proteins: VRILLE and PDP1ε. These proteins act in the clock positive feedback loop, inhibiting and resuming the expression of the  gene [42]. It is possible that the level and rhythmicity of these proteins is also altered, as in the case of PER protein, which in turn may cause the shift in the expression of  andt  clock genes in the mutants. However, more studies on other clock genes and proteins are needed. This shift can also be directly caused by the influence of oxidative stress and autophagy inhibition. We also found the co-localization of ATG5 and PDF in the somata of l-LNvs, which indicates that the clock proteins may also be degraded by autophagy. The l-LNvs are neurons in which the exam-ined genes are expressed as well as PER at certain time of the day [43–45]. We observed that the level of ATG5 in these cells is reduced in both mutants, which may confirm the relationship between autophagy and the circadian clock. The difference between the results obtained in  and  is most likely due to the various functions of these proteins. Although PARKIN and MUL1 proteins are mitochondrial ligases involved in mitophagy, they also participate in other physiological processes. MUL1 participates in SUMOylation, i.e., the additional post-translational processing of proteins. SUMOylation 
can stabilize some proteins, such as a glucose transporter, on the cell membrane and is therefore necessary for their proper functioning [46]. SUMOylation can also stabilize tau and alpha-synuclein proteins, and the inhibition of this process may lead to the development of Parkinson’s disease [47]. SUMOylation also protects proteins against free radicals [48]. Inhibition of SUMOylation can thereby increase the sensitivity of proteins to ROS.
The main function of the circadian clock is to generate circadian rhythms in many gene expression in clock cells and transmit this information via eferential pathways to other tissues, thereby regulating the expression of genes and proteins of physiological, as well as various behavioral processes. An example of such behavioral process is the previously described sleep duration, as well as the rhythm of locomotor activity, for which  positive neurons are responsible for [49, 50]. Our results showed that  and  mutations cause the rhythm of locomotor activity period to be prolonged. In the case of  mutation, it has already been confirmed by another group of scientists who received a result similar to ours [29]. Mutations of the tested genes abolish the rhythm of the PER protein, and as a result the information about chang-ing rhythms is erroneously transmitted to the effector tissues and disorders in the circadian rhythm of locomotor activity arise. This result is similar to the case in which 
 is mutated in many different forms [49, 50], which makes it even more convinced that  and  mutations lead to the circadian clock disruption. 
u 
In conclusion, in the present study, we found that and  mutations, which are involved in the development of Parkinson’s disease, disturb several processes in an organism, including circadian rhythms in behaviour and the molecular mechanism of the clock. This effect seems to originate from increased levels of free radicals and the inhibition of autophagy, which is important in circadian rhythm generation [51]. 
u 
 All raw data for the graphs presented in Figure 1. The sheets have numbered charts: Figure 1 - A, Figure 1 - B and Figure 1 - C respectively. In Figure 1 - A there are data for the survival curve. The “Day” column indicates in which day flies have died. The “Code‛ column means that the fly has died (1 - death). The “Group‛  column indicates the tested genotype. In Figure 1 - B there are data for the activity of the fruit fly: Total activity, sleep time during the day and at night, respectively. Columns marked “Minutes” indicate the time of activity/ sleep of the fruit fly measured within 24 h. In Figure 1 - C there are results showing period of circadian rhythm of locomotor activity measured for7 days under conditions of constant darkness. 
 All raw data for the graphs presented in Figure 1. The sheets have numbered charts: Figure 2 - A, Figure 2 – B, Figure 2 – C and Figure 2 -D respectively. In Figure 2 - A / B / C, there are presented results (RQ) for the expression of the ,  and  genes, respectively, at four time points. All data was averaged to the . Figures 2 - C show data for Western Blot analysis of PER protein. Data comes from densitometry, and has been averaged to load control - alpha tubulin 
 All raw data for the graphs presented in Figure 1. The sheets have numbered charts: Figure 3 – A and Figure 3 - B, respectively. Figure 3 - A shows the data for Western Blot analysis of the SOD1 protein. Results from densitometry have been averaged to load control - alpha tubulin. In Figure 3 - B there are data (fluorescence intensity measured using the ImageJ) showing the level of free radicals. 
 All raw data for the graphs presented in Figure 1. The sheets have numbered charts: Figure 4 – D and Figure 4 - E, respectively. Figure 4 - D shows the results (fluorescence intensity measured using the ImageJ) level of ATG5 protein in PDF-positive perycaryon of l-LNvs. In Figure 4 - E, the results of Western blot analysis of the ATG5 protein in the canine fruit fly are shown. Densitometry results were averaged to load control - alpha tubulin. 
PD: Parkinson’s disease; l-LNvs: large lateral neurons ventral; s-LNvs: small lateral neurons ventral; LNds: lateral neurons dorsal; DN: dorsal neurons; LPNs: lateral posterior neurons; PER: period; TIM: timeless; CLK: clock; CYC: cycle; DD: constant darkness; LD: light:dark. 
In this study we used a Zeiss LSM 510 confocal microscope in the Laboratory of Microscopy, Department of Cell Biology and Imaging, Institute of Zoology and Biomedical Research, Jagiellonian University. 
BD was conducting experiments and writing a first draft of the paper. MD helped in planning experiments and writing the paper. EP was involved in planning experiments, analyzing the results, writing the paper and she provided the funding. All authors read and approved the final manuscript. 
Supported from DSC 2017 Grant to BD and K/ZDS/007356, K/ZDS/008070 Grants of the Jagiellonian University. 
The datasets obtained and analysed during the current study are available from the first and corresponding Authors on request. 

Not applicable. 

Not applicable. 

The authors declare that they have no competing interests. 
Received:fh4fhOarchfh2019fhfhfhAccepved:fh15fhOayfh2019 


1. 	
Trevisan T, Pendin D, Montagna A, Bova S, Ghelli AM, Daga A. Manipulation of mitochondria dynamics reveals separate roles for form and function in mitochondria distribution. Cell Rep. 2018;23:1742–53. https://doi. <BR>org/10.1016/j.celrep.2018.04.017. 

2. 	
Zilocchi M, Finzi G, Lualdi M, Sessa F, Fasano M, Alberio T. Mitochondrial alterations in Parkinson’s disease human samples and cellular models. 


Dokvórfg l u 
Neurochem Int. 2018;118:61–72. https://doi.org/10.1016/j.neuin <BR><BR>t.2018.04.013. 


3. 	
Kitada T, Asakawa S, Hattori N, Matsumine H, Yamamura Y, Minoshima S, et al. Mutations in the parkin gene cause autosomal recessive juvenile parkinsonism. Nature. 1998;392:605–8. https://doi.org/10.1038/33416. 

4. 	
Valente EM, Abou-Sleiman PM, Caputo V, Muqit MMK, Harvey K, Gispert S, et al. Hereditary early-onset Parkinson’s disease caused by mutations in PINK1. Science. 2004;304(80):1158–60. https://doi.org/10.1126/scien <BR>ce.1096284. 

5. 	
Clark IE, Dodson MW, Jiang C, Cao JH, Huh JR, Seol JH, et al. Drosophila pink1 is required for mitochondrial function and interacts genetically with parkin. Nature. 2006;441:1162–6. https://doi.org/10.1038/nature0477 <BR>

9. 


6. 	
Park J, Lee SB, Lee SB, Kim Y, Song S, Kim S, et al. Mitochondrial dysfunction in Drosophila PINK1 mutants is complemented by parkin. Nature. 2006;441:1157–61. https://doi.org/10.1038/nature04788. 

7. 	
Matsuda N, Sato S, Shiba K, Okatsu K, Saisho K, Gautier CA, et al. PINK1 stabilized by mitochondrial depolarization recruits Parkin to damaged mitochondria and activates latent Parkin for mitophagy. J Cell Biol. 2010;189:211–21. 

8. 	
Narendra D, Tanaka A, Suen D-F, Youle RJ. Parkin is recruited selectively to impaired mitochondria and promotes their autophagy. J Cell Biol. 2008;183:795–803. https://doi.org/10.1083/jcb.200809125. 

9. 	
Yun J, Puri R, Yang H, Lizzio MA, Wu C. MUL1 acts in parallel to the PINK1/ parkin pathway in regulating mitofusin and compensates for loss of PINK1/parkin. 2014. P. 1–26. 

10. 	
Suzuki K, Okuma Y, Uchiyama T, Miyamoto M, Sakakibara R, Shimo Y, et al. Impact of sleep-related symptoms on clinical motor subtypes and disability in Parkinson’s disease: a multicentre cross-sectional study. J Neurol Neurosurg Psychiatry. 2017;88:953–9. https://doi.org/10.1136/jnnp-2017<BR>316136. 

11. 	
Ahsan Ejaz A, Sekhon IS, Munjal S. Characteristic findings on 24-h ambulatory blood pressure monitoring in a series of patients with Parkinson’s disease. Eur J Intern Med. 2006;17:417–20. https://doi.org/10.1016/j. <BR>ejim.2006.02.020. 

12. 	
Mistlberger RE. Circadian regulation of sleep in mammals: Role of the suprachiasmatic nucleus. Brain Res Rev. 2005;49:429–54. https://doi. <BR>org/10.1016/j.brainresrev.2005.01.005. 

13. 	
Tong J, Qin LQ, Wang DJ. Mechanism of pineal and suprachiasmatic regulation on circadian rhythm of body temperature in rats. Space Med Med Eng (Beijing). 2000;13:101–3. http://www.ncbi.nlm.nih.gov/pubme <BR>d/11543047. Accessed 15 May 2018. 

14. 	
Helfrich-Förster C. The circadian clock in the brain: a structural and functional comparison between mammals and insects. J Comp Physiol A. 2004;190:601–13. https://doi.org/10.1007/s00359-004-0527-2. 

15. 	
Peschel N, Helfrich-Förster C. Setting the clock—by nature: Circadian rhythm in the fruitfly . FEBS Lett. 2011;585:1435– 

42. https://doi.org/10.1016/j.febslet.2011.02.028. 


16. 	
Cha G-H, Kim S, Park J, Lee E, Kim M, Lee SB, et al. Parkin negatively regulates JNK pathway in the dopaminergic neurons of Drosophila. Proc Natl Acad Sci USA. 2005;102:10345–50. https://doi.org/10.1073/pnas.05003 <BR>46102. 

17. 	
Krstic D, Boll W, Noll M. Influence of the White locus on the courtship behavior of Drosophila males. PLoS ONE. 2013;8:e77904. https://doi. <BR>org/10.1371/journal.pone.0077904. 

18. 	
Rosato E, Kyriacou CP. Analysis of locomotor activity rhythms in Drosophila. Nat Protoc. 2006;1:559–68. https://doi.org/10.1038/nprot.2006.79. 

19. 	
Scialò F, Sriram A, Fernández-Ayala D, Gubina N, Lõhmus M, Nelson G, et al. Mitochondrial ROS produced via reverse electron transport extend animal lifespan. Cell Metab. 2016;23:725–34. https://doi.org/10.1016/j. <BR>cmet.2016.03.009. 

20. 	
Aitken RJ, Clarkson JS, Fishel S. Generation of reactive oxygen species, lipid peroxidation, and human sperm function. Biol Reprod. 1989;41:183– 

97. http://www.ncbi.nlm.nih.gov/pubmed/2553141. Accessed 19 Sep 2018. 


21. 	
Dean RT, Fu S, Stocker R, Davies MJ. Biochemistry and pathology of radical-mediated protein oxidation. Biochem J. 1997;324 (Pt 1):1–18. http://www.ncbi.nlm.nih.gov/pubmed/9164834. Accessed 19 Sept 2018. 

22. 	
Bunton-Stasyshyn RKA, Saccon RA, Fratta P, Fisher EMC. SOD1 function and its implications for amyotrophic lateral sclerosis pathology. Neuroscience. 2015;21:519–29. https://doi.org/10.1177/1073858414561795. 


23. 	
Henchcliffe C, Beal MF. Mitochondrial biology and oxidative stress in Parkinson disease pathogenesis. Nat Clin Pract Neurol. 2008;4:600–9. https:// <BR>doi.org/10.1038/ncpneuro0924. 

24. 	
Matus S, Lisbona F, Torres M, León C, Thielen P, Hetz C. The stress rheostat: an interplay between the unfolded protein response (UPR) and autophagy in neurodegeneration. Curr Mol Med. 2008;8:157–72. http:// <BR>www.ncbi.nlm.nih.gov/pubmed/18473817. Accessed 19 Sept 2018. 

25. 	
Li D-Y, Yu J-C, Xiao L, Miao W, Ji K, Wang S-C, et al. Autophagy attenuates the oxidative stress-induced apoptosis of Mc3T3-E1 osteoblasts. Eur Rev Med Pharmacol Sci. 2017;21:5548–56. http://www.ncbi.nlm.nih.gov/ <BR>pubmed/29271985. Accessed 15 May 2018. 

26. 	
Cai D, Liu T. Inflammatory cause of metabolic syndrome via brain stress and NF-κB. Aging (Albany NY). 2012;4:98–115. https://doi.org/10.18632/ <BR>aging.100431. 

27. 	
Yang Y, Gehrke S, Imai Y, Huang Z, Ouyang Y, Wang J-W, et al. Mitochondrial pathology and muscle and dopaminergic neuron degeneration caused by inactivation of Drosophila Pink1 is rescued by Parkin. Proc Natl Acad Sci USA. 2006;103:10793–8. 

28. 	
Wen J-K, Wang Y-T, Chan C-C, Hsieh C-W, Liao H-M, Hung C-C, et al. Atg9 antagonizes TOR signaling to regulate intestinal cell growth and epithelial homeostasis in Drosophila. Elife. 2017. https://doi.org/10.7554/elife.29338 <BR>. 

29. 	
Julienne H, Buhl E, Leslie DS, Hodge JJL. Drosophila PINK1 and parkin loss-of-function mutants display a range of non-motor Parkinson’s disease phenotypes. Neurobiol Dis. 2017;104:15–23. https://doi. <BR>org/10.1016/j.nbd.2017.04.014. 

30. 	
Cavanaugh DJ, Vigderman AS, Dean T, Garbe DS, Sehgal A. The Drosophila circadian clock gates sleep through time-of-day dependent modulation of sleep-promoting neurons. Sleep. 2016;39:345–56. https:// <BR>doi.org/10.5665/sleep.5442. 

31. 	
Zhou L, Bryant CD, Loudon A, Palmer AA, Vitaterna MH, Turek FW. The circadian clock gene Csnk1e regulates rapid eye movement sleep amount, and nonrapid eye movement sleep architecture in mice. Sleep. 2014;37:785–93. https://doi.org/10.5665/sleep.3590. 

32. 	
Parisky KM, Agosto J, Pulver SR, Shang Y, Kuklin E, Hodge JJL, et al. PDF cells are a GABA-responsive wake-promoting component of the Drosophila sleep circuit. Neuron. 2008;60:672–82. https://doi.org/10.1016/J. <BR>NEURON.2008.10.042. 

33. 	
Hardin PE, Hall JC, Rosbash M. Feedback of the Drosophila period gene product on circadian cycling of its messenger RNA levels. Nature. 1990;343:536–40. https://doi.org/10.1038/343536a0. 

34. 	
Lee IC, Ho XY, George SE, Goh CW, Sundaram JR, Pang KKL, et al. Oxidative stress promotes SIRT1 recruitment to the GADD34/PP1α complex to activate its deacetylase function. Cell Death Differ. 2018;25:255–67. https <BR>://doi.org/10.1038/cdd.2017.152. 

35. 	
Grima B, Lamouroux A, Chélot E, Papin C, Limbourg-Bouchon B, Rouyer F. The F-box protein Slimb controls the levels of clock proteins period and timeless. Nature. 2002;420:178–82. https://doi.org/10.1038/nature01122. 

36. 	
Tamaru T, Hattori M, Ninomiya Y, Kawamura G, Varès G, Honda K, et al. ROS stress resets circadian clocks to coordinate pro-survival signals. PLoS ONE. 2013;8:e82006. https://doi.org/10.1371/journal.pone.0082006. 

37. 	
Lin J-M, Kilman VL, Keegan K, Paddock B, Emery-Le M, Rosbash M, et al. A role for casein kinase 2α in the Drosophila circadian clock. Nature. 2002;420:816–20. https://doi.org/10.1038/nature01235. 

38. 	
Tahara Y, Shibata S. Entrainment of the mouse circadian clock: effects of stress, exercise, and nutrition. Free Radic Biol Med. 2018;119:129–38. https <BR>://doi.org/10.1016/j.freeradbiomed.2017.12.026. 

39. 	
Akten B, Jauch E, Genova GK, Kim EY, Edery I, Raabe T, et al. A role for CK2 in the Drosophila circadian oscillator. Nat Neurosci. 2003;6:251–7. https:// <BR>doi.org/10.1038/nn1007. 

40. 	
Cyran SA, Buchsbaum AM, Reddy KL, Lin M-C, Glossop NRJ, Hardin PE, et al. vrille, Pdp1, and dClock form a second feedback loop in the Drosophila circadian clock. Cell. 2003;112:329–41. http://www.ncbi.nlm.nih. <BR>gov/pubmed/12581523. Accessed 15 May 2018. 

41. 	
Kloss B, Price JL, Saez L, Blau J, Rothenfluh A, Wesley CS, et al. The Drosophila clock gene double-time encodes a protein closely related to human casein kinase Iepsilon. Cell. 1998;94:97–107. http://www.ncbi.nlm. <BR>nih.gov/pubmed/9674431. Accessed 15 May 2018. 

42. 	
Blau J, Young MW. Cycling vrille expression is required for a functional Drosophila clock. Cell. 1999;99:661–71. https://doi.org/10.1016/S0092 <BR>-8674(00)81554-8. 


43. 	
Myers MP, Wager-Smith K, Rothenfluh-Hilfiker A, Young MW. Lightinduced degradation of TIMELESS and entrainment of the Drosophila circadian clock. Science. 1996;271:1736–40. http://www.ncbi.nlm.nih. <BR>gov/pubmed/8596937. Accessed 20 Sep 2018. 

44. 	
Siwicki KK, Eastman C, Petersen G, Rosbash M, Hall JC. Antibodies to the period gene product of Drosophila reveal diverse tissue distribution and rhythmic changes in the visual system. Neuron. 1988;1:141–50. http:// <BR>www.ncbi.nlm.nih.gov/pubmed/3152288. Accessed 20 Sep 2018. 

45. 	
Zerr DM, Hall JC, Rosbash M, Siwicki KK. Circadian fluctuations of period protein immunoreactivity in the CNS and the visual system of Drosophila. J Neurosci. 1990;10:2749–62. http://www.ncbi.nlm.nih.gov/pubme <BR>d/2117644. Accessed 20 Sep 2018. 

46. 	
Giorgino F, de Robertis O, Laviola L, Montrone C, Perrini S, McCowen KC, et al. The sentrin-conjugating enzyme mUbc9 interacts with GLUT4 and GLUT1 glucose transporters and regulates transporter levels in skeletal muscle cells. Proc Natl Acad Sci USA. 2000;97:1125–30. http://www.ncbi. <BR>nlm.nih.gov/pubmed/10655495. Accessed 15 May 2018. 

47. 	
Dorval V, Fraser PE. Small ubiquitin-like modifier (SUMO) modification of natively unfolded proteins Tau and α-synuclein. J Biol Chem. 2006;281:9919–24. https://doi.org/10.1074/jbc.M510127200. 


48. 	
Marcelli S, Ficulle E, Piccolo L, Corbo M, Feligioni M. An overview of the possible therapeutic role of SUMOylation in the treatment of Alzheimer’s disease. Pharmacol Res. 2018;130:420–37. https://doi.org/10.1016/j. <BR>phrs.2017.12.023. 

49. 	
Huang ZJ, Curtin KD, Rosbash M. PER protein interactions and temperature compensation of a circadian clock in Drosophila. Science. 1995;267:1169–72. http://www.ncbi.nlm.nih.gov/pubmed/7855598. Accessed 20 Sept 2018. 

50. 	
Loros JJ, Denome SA, Dunlap JC. Molecular cloning of genes under control of the circadian clock in Neurospora. Science. 1989;243:385–8. http:// <BR>www.ncbi.nlm.nih.gov/pubmed/2563175. Accessed 20 Sept 2018. 

51. 	
Kijak E, Pyza E. TOR signaling pathway and autophagy are involved in the regulation of circadian rhythms in behavior and plasticity of L2 interneurons in the brain of Drosophila melanogaster. PLoS ONE. 2017;12:e0171848. https://doi.org/10.1371/journal.pone.0171848. 


t Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. 
ORIGINAL <BR>RESEARCH <BR>
published: 14 February 2019 doi: 10.3389/fnins.2019.00094 

Edited by: 

Giuseppe Pignataro, University of Naples Federico II, Italy 
Reviewed by: 

Serge Birman, École Supérieure de Physique et de Chimie Industrielles de la Ville de Paris, France Philipp Janker Kahle, Hertie-Institut für klinische Hirnforschung (HIH), Germany 
*Correspondence: 
Elzbieta Pyza elzbieta.pyza@uj.edu.pl 
Specialty section: 
This article was submitted to Neurodegeneration, a section of the journal Frontiers in Neuroscience 

Received: 03 December 2018 Accepted: 25 January 2019 Published: 14 February 2019 
Citation: 

Doktór B, Damulewicz M and Pyza E (2019) Overexpression of Mitochondrial Ligases Reverses Rotenone-Induced Effects in a Drosophila Model of Parkinson’s Disease. Front. Neurosci. 13:94. doi: <BR>10.3389/fnins.2019.00094 <BR>
Overexpression <BR>of <BR>Mitochondrial <BR>Ligases <BR>Reverses <BR>Rotenone-Induced <BR>Effects <BR>in <BR>a <BR>Drosophila <BR>Model <BR>of <BR>Parkinson’s <BR>Disease <BR>
Bartosz <BR>Doktór, <BR>Milena <BR>Damulewicz <BR>and <BR>Elzbieta <BR>Pyza* <BR>
Department of Cell Biology and Imaging, Institute of Zoology and Biomedical Research, Jagiellonian University, Kraków, Poland 
Mul1 and Park are two major mitochondrial ligases responsible for mitophagy. Damaged mitochondria that cannot be removed are a source of an increased level of free radicals, which in turn can destructively affect other cell organelles as well as entire cells. One of the toxins that damages mitochondria is rotenone, a neurotoxin that after exposure displays symptoms typical of Parkinson’s disease. In the present study, we showed that overexpressing genes encoding mitochondrial ligases protects neurons during treatment with rotenone. Drosophila strains with overexpressed mul1 or park show a significantly reduced degeneration of dopaminergic neurons, as well as normal motor activity during exposure to rotenone. In the nervous system, rotenone affected synaptic proteins, including Synapsin, Synaptotagmin and Disk Large1, as well as the structure of synaptic vesicles, while high levels of Mul1 or Park suppressed degenerative events at synapses. We concluded that increased levels of mitochondrial ligases are neuroprotective and could be considered in developing new therapies for Parkinson’s disease. 
Keywords: mul1, park, synapses, autophagy, apoptosis, neurodegeneration 
INTRODUCTION 

Mitochondria are “the powerhouses of the cell” playing a crucial role in the control of intracellular metabolism. The main processes in mitochondria are electron transport and proton pumping with the energetic steps (oxidative phosphorylation) that harness the energy as ATP. However, these processes are not without risk for cells, and the electron transport chain is sensitive to multiple external stressors. One of the functional disturbances within mitochondria is the stressedinduced massive production of reactive oxygen radicals e.g., the superoxide anion (O2•−). These dismutate toward hydrogen peroxide (H2O2), which can subsequently react to become hydroxyl radicals (HO•) <BR>that <BR>are <BR>most <BR>harmful <BR>and <BR>destructive <BR>to <BR>cells <BR>(Sena <BR>and <BR>Chandel, <BR>2012; Kehrer <BR>and <BR>Klotz, <BR>2015). Numerous proteins, such as ligases and mitochondrial kinases, are responsible for the control of mitochondrial stability and their biological maintenance, with the main function of <BR>mitophagy <BR>(Youle <BR>and <BR>Narendra, <BR>2011). This process involves the removal of damaged, old, or <BR>improperly <BR>functioning <BR>mitochondria <BR>by <BR>autophagy <BR>(Cornelissen <BR>et <BR>al., <BR>2018). Disrupting mitochondrial processes may lead to the development of many diseases such as Parkinson’s disease (PD), a neurodegenerative disease. Given their high energy demands, neurons are cells that are most <BR>sensitive <BR>to <BR>mitochondrial <BR>damage <BR>(Trevisan <BR>et <BR>al., <BR>2018; Zilocchi <BR>et <BR>al., <BR>2018). <BR>
Frontiers in Neuroscience | www.frontiersin.org 1 February 2019 | Volume 13 | Article 94 Doktór et al. Mitochondrial Ligases Reverse Rotenon Toxicity 
Two important and well-described mitochondrial proteins whichcontrolthestabilityofmitochondriaaretheMul1andPark E3ubiquitinligases.Theseproteinsareresponsibleforpromoting mitophagy and maintaining mitochondrial integrity and fusionfission processes in Drosophila (Kitada <BR>et <BR>al., <BR>1998; Yun <BR>et <BR>al., <BR>2014). <BR>Mul1 <BR>is <BR>also <BR>involved <BR>in <BR>SUMOylation. <BR>Mutations <BR>in <BR>the <BR>genes encoding Mul1 and Park in Drosophila lead to typical PD symptoms such as motor disorders, sleep problems and degeneration <BR>of <BR>dopaminergic <BR>neurons <BR>(Clark <BR>et <BR>al., <BR>2006; Park <BR>et <BR>al., <BR>2006; <BR>Yun <BR>et <BR>al., <BR>2014; <BR>Gokcal <BR>et <BR>al., <BR>2017). <BR>The <BR>above <BR>symptoms may also be caused by various neurotoxins, one of which is rotenone. The mechanism of its action is based on the disruption of electron transport in mitochondria. It inhibits the transport of electrons from iron-sulfur centers in complex I <BR>on <BR>ubiquinone <BR>(Lindahl <BR>and <BR>Öberg, <BR>1961). As a result, it triggers mitochondrial damage by increasing oxidative stress, leading to neuronal death. However, cells can counteract these changes by enhancing the activity of antioxidative enzymes i.e., catalase,superoxidedismutase,hemeoxygenase-1,orglutathione peroxidase. All these proteins protect cells from oxidative stress-mediated <BR>programmed <BR>cell <BR>death, <BR>or <BR>apoptosis <BR>(Silva <BR>and <BR>Coutinho, <BR>2010). <BR>
Neurodegenerative diseases can be studied using animal models, including the fruit fly Drosophila melanogaster. The Drosophila genome carries homologs of most of the genes involved in the development of Parkinson’s disease, with the notable exception of α-synuclein <BR>(Nagoshi, <BR>2018). In addition, current genetic tools and their short period of development, allows successful manipulation of its genome to be performed (Duffy, <BR>2002). Symptoms typical of Parkinson’s disease, e.g., dopaminergic neuron degeneration and motor disorders, can be induced in Drosophila by various neurotoxins, such as rotenone, which has been used in the present study, and MPTP (1methyl-4-phenyl-1,2,3,6-tetrahydropyridine).Bothtoxinsinduce symptomstypicalofParkinson’sdiseaseviamechanismslinkedto oxidative <BR>stress <BR>(Coulom <BR>and <BR>Birman, <BR>2004; Abolaji <BR>et <BR>al., <BR>2018). <BR>
In the present study, we examined whether the strong expression of two major mitochondrial ligases may protect flies exposed to rotenone, against developing symptoms typical of Parkinson’s disease. We found that overexpressing genes encoding Mul1 and Park in all neurons in the Drosophila brain inhibits degeneration of dopaminergic neurons and the motor disorders caused by rotenone. In addition, we found that rotenone affects the structure of synapses and the expression of synapticproteinsin the brainof flies,butwhenthelevels ofMul1 and Park were increased in parallel, synapse structure and the normal level of synaptic proteins were restored. 
MATERIALS AND METHODS 
Animals 
The following strains were used for the experiments: Canton S (obtained from Bloomington Drosophila Stock Centre), elavGal4 (expressing the yeast transcription factor GAL4 under control of the elav promoter, obtained from Bloomington Drosophila Stock Centre), UAS-park (overexpressing park under UAS control, kindly provided by Dr. Alex Whitworth, University of Sheffield, United Kingdom) and UAS-mul1 overexpressing mul1 underUAScontrol,kindlydonatedbyDr.MingGuo,Brain Research Institute, United States. Measured using qPCR in 7days old males, the level of park (elav-GAL4 > UAS-park) and mul1 (elav-GAL4 > UAS-MUL1) expression equaled 220 and 430%, of the control values, respectively. Flies were maintained on a standard yeast-cornmeal-agar medium at 25 ± 1◦C, under a day/night cycle LD 12:12 (12 h of light and 12 h of darkness). For the experiments, adult flies were transferred for 7 days to flasks containing cotton soaked with a 10% sucrose (BioShop) solution with either DMSO (control) or 500 µM rotenone (Sigma)dissolvedinDMSOand10%sucrose(experimentalflies). 
Climbing Assay to Test Negative Geotaxis 
Males, 7 days old (N = 30), were transferred into an empty vial. After a short recovery, flies were gently tapped to the bottom of theirvialandafter16 sindividualsthatclimbed verticallybeyond a 5-cm marked line were counted. The experiment was carried out in dim red light under constant conditions and was repeated three times. 
Locomotor Activity and Sleep Analysis 
Seven-day old male flies (N = 32), were transferred to small glass tubes containing the sugar-agar food medium. Vials were located in DAMS monitors (Drosophila Activity Monitoring System, TriKinetics) and placed in an incubator (25◦C). Monitors were equipped with infrared sensors, which automatically recorded activity of the flies inside their vials every 5 min. For the first 5 days, monitors were held in LD 12:12 (12 h of light and 12 h of darkness) conditions and in constant darkness (DD) for the next 6 days. Results from the second day of recording were analyzed to estimate the total activity and duration of sleep during the day and night usingaMicrosoft Excel plugin – BeFly (kindly donated by Dr. E. Green from the Department of Genetics, University of Leicester) <BR>(Rosato <BR>and <BR>Kyriacou, <BR>2006) <BR>and <BR>Python <BR>221. <BR>Sleep <BR>in <BR>flies is defined as the time for which they do not change their position for at least 5 min. The experiment was repeated three times. In LD 12:12 and DD the rhythm of locomotor activity was analyzed, and its period was measured in DD. 
Whole Brain Immunohistochemistry 
Seven-day old male flies were fixed in 4% paraformaldehyde in 0.2% PBT for 3 h at 4◦C. Isolated brains were washed six times in PBS for 5 min each time. Next, they were incubated in 5% normal goat serum (NGS) and 0.5% bovine serum albumin (BSA) for 30 min at room temperature. Subsequently, brains were incubated overnight with mouse primary anti-Tyrosine Hydroxylase (1:1000, ImmunoStar) serum. After, brains were washed six times in 0.2% PBT for 5 min each and incubated overnight at 4◦C with secondary goat anti-mouse Cy3-conjugated (1:500, Jackson ImmunoResearch Lab) antibodies. Finally, brains were washed four times in 
1http://www.python.org/ <BR>
Frontiers in Neuroscience | www.frontiersin.org 2 February 2019 | Volume 13 | Article 94 Doktór et al. Mitochondrial Ligases Reverse Rotenon Toxicity 
0.2% PBT, twice in PBS and mounted in a Vectashield medium and examined with a Zeiss LSM780 Laser Scanning confocal Microscope. 
Western Blots 
Seven-day old male flies (N = 30) were frozen in liquid nitrogen and decapitated. Heads were homogenized by sonication in 30 µl of Laemmli buffer with a protease inhibitor (Boehringer, Mannheim), left for 30 min at 4◦C and frozen at −20◦C. Homogenates were centrifuged at 13,200 rpm for 1 h at 4◦C. Supernatants were collected and denatured at 85◦C for 5 min. ThetotalproteinlevelwasmeasuredbyaQuant-iTProteinAssay Kit and Qubit fluorometer (Invitrogen). Afterward, 20 µg of protein from each supernatant was subjected to electrophoresis (NuPAGE 4–12% bis-Tris gels, Invitrogen) at 165 V for 40 min and then blotted by electrotransfer onto a PVDF membrane (Invitrogen) at 30 V for 60 min. The membrane was blocked in 5% non-fat dry milk in PBS with 0.1% Tween20 (TBS) for 1 h at 4◦C and incubated with primary antibodies; antiα tubulin (1:20 000, Abcam), anti-Synaptotagmin (3H2 2D7, 1:2, Developmental Studies Hybridoma Bank), anti-Synapsin (3C11, dilution 1:1000, Developmental Studies Hybridoma Bank), anti-Sod1 (1:5000, abgent), anti-Atg5 (1:500, Abcam), anti-Disklarge1(4F3,1:1000,DevelopmentalStudiesHybridoma Bank) and anti-Dcp-1 (1:1000, Cell Signaling) in 1% BSA in 0.1% TBS overnight at 4◦C. Next, the membrane was washed 5 times in 0.1% TBS for 10 min and incubated with the secondary antibody conjugated with HRP (1: 10 000, Abcam) in 1% BSA in 0.1% TBS for 1 h at room temperature. Afterward the incubation membrane was washed five times in 0.1% TBS and immunodetected with the ECL detection system (Perkin Elmer). Densitometric analysis of Western Blots was performed by ImageJ. The experiment was repeated three times. 
qPCR 
Seven-day old male flies were decapitated and their heads were fixed in 100% ethanol for 2 h, and the brains were isolated. Total RNA was isolated using TriReagent (MRC Inc.). Total RNA (5 µg) was used for reverse transcription [High-Capacity cDNA Reverse Transcription Kit (ThermoFisher)] according to the manufacturer’s protocol. 1000 ng cDNA (diluted 1:10) was used for quantitative PCR. Each experiment was repeated three times. Expression of the following genes was examined using SYBR Green (ThermoFisher) and primers (Genoplast): 
rpl32: F – TATGCTAAGCTGTCGCACAAATG, 
R – GAACTTCTTGAATCCGGTGGGC 
dlg1: F – ACCTGGAGAACGTAACGCAC, 
R – ATGCACCTGACTTTGGCTCT 
synaptotagmin: F – CTGAGTCCGGTCTTCAACGAG, 
R – ACACGAGCGTCTTGTTCATGG 
synapsin: F – ACCGGCATTCAGCAAGGAC, 
R – CCCGGAAGTATTTGGACCAGT 
atg5: F – CCGGAGCCTTTCTATCTGATGA, 
R – CCTGGTGTTCGGCGCTTAT 
sod1: F-GGACCGCACTTCAATCCGTA, R – TTGACTTGCTCAGCTCGTGT park: F – ATTTGCCGGTAAGGAACTAAGC, R – AAGTGGCCGACTGGATTTTCT mul1: F – GCTATTGGTGAACTGGAGTTGGA, R – AGCTTGAGTATCGTCGTTGTCTT 
ThereactionwasperformedusingaStepOnePlusReal-TimePCR System (ThermoFisher). Data were collected as raw CT values and analyzed using the 2-��CT method. Gene expression was normalized on an arbitrary scale with the control. 
Transmission Electron Microscopy (TEM) 
Heads of 1-week old males were fixed in cacodyl-buffered PFA (2.5%) and glutaraldehyde (2%) primary fixative for 2 h. They were post-fixed for 1 h in OsO4 (2%) in veronal acetate buffer. Subsequently, the heads were dehydrated in an alcohol series followed bypropyleneoxideand then embedded in Poly/Bed 812 resin (Polysciences). Ultrathin sections (65 nm thick) of the first neuropil (lamina) of the optic lobe were cut and contrasted with uranyl acetate and lead citrate. Images of tetrad synapses in the lamina, as a convenient type of characteristic synaptic contact, were taken using a Jeol JEM 2100 HT TEM. The experiment was repeated three times. Ten images were taken per repetition. 
Statistics 
Statistical analyses were performed using the GraphPad Prism 6. Data were examined for distribution normality, and statistical tests were chosen accordingly. The Wilcoxon–Mann–Whitney and Kruskal–Wallis tests were performed to assess differences in sleep, total activity and for climbing assay results. The results obtained from the Western blot, for qPCR data, and immunohistochemistry were analyzed using a one-way ANOVA and Tukey test. 
RESULTS 
The Effect of Mul1 or Park Overexpression on Motor Activity 
The analysis of D. melanogaster behavior revealed that overexpressing two major mitochondrial ligases in neurons increased the climbing ability and motor activity in flies treated with rotenone. Rotenone exposure reduced the climbing of flies by approximately 80% when compared with the control flies (p < 0.001) <BR>(Figure <BR>1A). <BR>Overexpression <BR>of <BR>mul1 or park in neurons of flies fed with rotenone, reversed this result and increased climbing by up to 70 and 60% in elav > mul1 and elav > park, respectively, compared with the control strains (elav-Gal4 and UAS-mul1 for elav > mul1 and elav-Gal4 and UAS-park for elav > park)(p < 0.001). However, the overexpression of each of those two genes did not affect the climbing activity of untreated flies. Total activity during the day was also decreased after rotenone exposure by about 20%. Overexpression of mul1 or park enhanced this activity in the control strains, and the differences between strains that overexpressed mul1 or park were statistically significant relative to the controls (p < 0.05). It is worth 
Frontiers in Neuroscience | www.frontiersin.org 3 February 2019 | Volume 13 | Article 94 Doktór et al. Mitochondrial Ligases Reverse Rotenon Toxicity 

noting that the overexpression of mul1 or park restored the same activity level in experimental strains as in the control (p < 0.01) <BR>(Figure <BR>1B). <BR>It <BR>should <BR>be <BR>pointed <BR>out <BR>that <BR>although <BR>the total activity was decreased, rotenone did not affect the length of sleep, neither during the day nor during the night (Figures <BR>1C,D), <BR>while <BR>overexpressing <BR>mul1 or park decreased sleep duration during the day, in both the experimental and control individuals by up to 20%, an increase that is statistically significant in control flies (p < 0.05) as well as in experimental strains (p < 0.01). 
The Effect of Mul1 or Park Overexpression on Synaptic Proteins 
Analyses of the selected synaptic protein levels in the fly’s brain showed that rotenone reduces the abundance of these 
Frontiers in Neuroscience | www.frontiersin.org 4 February 2019 | Volume 13 | Article 94 Doktór et al. Mitochondrial Ligases Reverse Rotenon Toxicity 

proteins, while overexpressing ligases restores their normal level in flies exposed to rotenone. Exposure to 500 µM rotenone reduced <BR>the <BR>level <BR>of <BR>Dlg1 <BR>(Figure <BR>2A), <BR>Synapsin <BR>(Figure <BR>2B) and <BR>Synaptotagmin <BR>(Figure <BR>2C) <BR>to <BR>about <BR>50% <BR>compared <BR>with <BR>the control. In the case of Dlg1 protein, statistically significant differences were found between elav > mul1 and elav-Gal4 (p < 0.001), and UAS-mul1 (p < 0.01), and also between elav > park and elav-Gal4,andUAS-park (p< 0.001)treatedwith rotenone. Differences between strains with overexpressed ligases in neurons and their respective controls were at p < 0.01 and p < 0.05,inthecaseofSynapsinandSynaptotagmin,respectively. The highest reduction of synaptic protein levels was observed in elav-Gal4/+ in all proteins examined. Overexpressing mul1 or parkdidnotaffecttheleveloftheseproteinsinthecontrols,butin all strains fed with the neurotoxin, the normal level was restored for Synapsin and Synaptotagminwhile the Dlg1 proteinlevel was about 20% higher than in the control. Both, rotenone and the overexpression of mitochondrial ligases did not affect expression of <BR>genes <BR>encoding <BR>the <BR>protein <BR>examined <BR>(Figures <BR>2D–F). <BR>
The Effect on Synapses of Rotenone and Overexpressing Mitochondrial Ligases 
TEM <BR>micrographs <BR>(Figure <BR>3) <BR>of <BR>synapses <BR>examined <BR>in <BR>the <BR>laminaofthe Drosophila visualsystemshowedsynapsedistortion after exposure to rotenone. Among flies fed with rotenone, the presynaptic T-bar was smaller, and especially its platform, to which synaptic vesicles are attached, was smaller than in the control. Moreover, synaptic vesicles with irregular shapes were observed. They were more translucent than normal vesicles and their membrane was often broken. In strains with the overexpression of mul1 or park, the active zone was large, with a clearly visible large T-bar platform, while synaptic vesicles were mostly round and electron dense, indicating they contained a transported cargo. 
The Effect of Mul1 or Park Overexpression on Dopaminergic Neurons 
Approximately 140 dopaminergic neurons have been described in six clusters per hemisphere in the brain of Drosophila by means <BR>of <BR>anti-TH <BR>antibodies <BR>(Nässel <BR>and <BR>Elekes, <BR>1992; Pech <BR>et <BR>al., <BR>2013); <BR>however, <BR>in <BR>the <BR>present <BR>study <BR>not <BR>all <BR>neurons <BR>from <BR>the <BR>PAM <BR>cluster <BR>were <BR>visualized <BR>(Figure <BR>4A). <BR>Rotenone <BR>exposure caused degeneration of dopaminergic neurons in the five clusters that were examined, so that the number of these neurons <BR>was <BR>reduced <BR>by <BR>23% <BR>in <BR>total <BR>(Figure <BR>4C). <BR>In <BR>the <BR>case of the PAL, PPM1/2, and PPM3 clusters, the differences 
Frontiers in Neuroscience | www.frontiersin.org 5 February 2019 | Volume 13 | Article 94 Doktór et al. Mitochondrial Ligases Reverse Rotenon Toxicity 

Frontiers in Neuroscience | www.frontiersin.org 6 February 2019 | Volume 13 | Article 94 Doktór et al. Mitochondrial Ligases Reverse Rotenon Toxicity 
between strains with overexpressed ligases in their neurons and the corresponding elav-Gal4 control, were statistically significant at p < 0.01; between the same strains and their UAS controls the differences were significant at p < 0.05. In the PPL1 and PPL2 clusters, the differences between elav > mul1 and elav > park and their controls were also statistically significant at p < 0.05. The increased level of Mul1 or Park in all neurons prevented neurodegeneration in toxin-fed individuals and the number of dopaminergic neurons was the same as in the control. The overexpression of mul1 or park in the control strains did not change the number of dopaminergic cells in their brains <BR>(Figure <BR>4B). <BR>
The Effect of Overexpression of Mul1 or Park and Rotenone on Autophagy and Apoptosis 
Rotenone also reduced the abundance of proteins involved in removing damaged organelles or entire cells from the body. It reduced the level of the Atg5 autophagy protein by about 30% (p < 0.05) when compared with all strains that were not fed the toxin, while the overexpression of mul1 or park restored the normal level of Atg5 in rotenone-fed flies compared to Gal4 and UAS controls (p < 0.01) <BR>(Figure <BR>5A). <BR>In <BR>the <BR>case <BR>of <BR>the <BR>protein <BR>Sod1, the profile was the same, while statistically significant differences were higher, between strains which overexpressed mul1 or park compared with their rotenone-fed experimental groups (p < 0.001) <BR>(Figure5B). <BR>Both <BR>rotenone <BR>and <BR>the <BR>increased <BR>level of Mul1 and Park did not change the expression of genes encoding <BR>these <BR>proteins <BR>(Figures <BR>5D,E). <BR>Rotenone <BR>exposure <BR>also <BR>increased the Dcp-1 protein by about 100% in the brain of the fruit fly compared with Gal4 and UAS strains (p < 0.05) (Figure5C).Afteroverexpressingtheligasesstudiedinrotenone<BR>fed flies, the level of Dcp-1 was restored to the normal level, and this was also observed in individuals that were not treated with the toxin (p < 0.05). 
DISCUSSION 
Rotenone is a toxin that inhibits activity of the mitochondrial complex I and increases production of the radical oxygen species level,as <BR>shown <BR>in <BR>rats <BR>(Betarbetet <BR>al., <BR>2000). In the present study, we showed that exposure to 500 µM rotenone in Drosophila (Coulom <BR>and <BR>Birman, <BR>2004) reduces the levels of Atg5 and Sod1, which are important for cell survival under stress. Sod1 is an enzyme that is responsible for the elimination of free radicals <BR>from <BR>cells <BR>(Bunton-Stasyshyn <BR>et <BR>al., <BR>2015). Its low-level leads to hypergeneration of reactive oxygen species in the cell and <BR>its <BR>presence <BR>triggers <BR>cellular <BR>damage <BR>(Henchcliffe <BR>and <BR>Beal, <BR>2008). <BR>Atg5 <BR>is <BR>one <BR>of <BR>the <BR>major <BR>proteins <BR>involved <BR>in <BR>autophagy, <BR>during which damaged organelles can be removed and amino acid <BR>obtained <BR>for <BR>cell <BR>survival <BR>and <BR>homeostasis <BR>in <BR>mice <BR>(Kuma <BR>et <BR>al., <BR>2004). <BR>The <BR>enhanced <BR>autophagy <BR>during <BR>high <BR>oxidative <BR>stress is beneficial for cells and delays the degenerative processes in <BR>rat <BR>cells <BR>(Chen <BR>et <BR>al., <BR>2014). Its disruption is critical for PD pathogenesis in non-dopaminergic neurons and for the onset of non-motor <BR>symptoms <BR>in <BR>rats <BR>(Wise <BR>et <BR>al., <BR>2018). The suppression of autophagy has an adverse effect on the elimination of free radicals <BR>(Navarro-Yepes <BR>et <BR>al., <BR>2014) and we demonstrated that rotenone also affects apoptosis by increasing the level of Dcp1 <BR>in <BR>fruit <BR>flies <BR>(Xu <BR>et <BR>al., <BR>2009). It has already been observed that rotenone exposure induces changes in the level of several apoptotic proteins such as Bcl2, Bax, Caspase-8, and Cyt-C in rats <BR>(Dhanalakshmi <BR>et <BR>al., <BR>2016) and that autophagy prevents oxidative <BR>stress-dependent <BR>apoptosis <BR>(Li <BR>et <BR>al., <BR>2017). 
Our results also showed that rotenone exposure disturbs climbing ability and locomotor activity of flies, during the day. This is most likely caused by increased free radical levels and <BR>apoptosis <BR>which <BR>have <BR>been <BR>observed <BR>in <BR>rats <BR>(Rosiñczuk <BR>et <BR>al., <BR>2018), <BR>particularly <BR>in <BR>neurons, <BR>leading <BR>to <BR>neuronal <BR>disorders. It has been reported that oxidative stress is associated with <BR>behavioral <BR>disorders <BR>in <BR>mice <BR>(Camargo <BR>et <BR>al., <BR>2018) and we demonstrated that the mul1 or park overexpression in neurons can restore the normal level of apoptosis and increase autophagy and endogenous antioxidant enzyme levels. As a result, improvements in climbing and locomotor activity were observed. The results obtained also showed that overexpressing the ligases studied causes hyperactivity in flies and reduces their sleep time during the day. It has already been reported that increases in the level of mitophagy results in increased motor <BR>activity <BR>levels <BR>in <BR>fruit <BR>flies <BR>(Chakraborty <BR>et <BR>al., <BR>2018) and this can explain hyperactivity in flies with higher levels of mitochondrial ligases. Mul1 and Park enhance mitochondrial fusion, so increasing their amount in neurons, most likely leads to the increased number of large mitochondria. In turn, large <BR>mitochondria <BR>produce <BR>more <BR>ATP <BR>than <BR>smaller <BR>ones <BR>(Sun <BR>et <BR>al., <BR>2014), <BR>which <BR>in <BR>turn <BR>may <BR>increase <BR>the <BR>motor <BR>activity <BR>of Drosophila. Higher levels of Nix protein, a mitochondrial autophagy receptor, likewise increases ATP levels in strains that are also genetic models of Parkinson’s disease and shows that ATP <BR>levels <BR>depend <BR>on <BR>the <BR>quality <BR>of <BR>mitophagy <BR>(Koentjoro <BR>et <BR>al., <BR>2017).Appropriatemitochondrialqualitycanalsobeprovidedby <BR>Afadin6,anF-actinbindingmultidomain-containingscaffolding protein. This protein interacts with Park, as also reported in fruit flies, and its overexpression restores the physiological phenotype in the pink and park mutants <BR>(Basil <BR>et <BR>al., <BR>2017). Our results suggestthattheincreasedexpressionofparkormul1canalsolead to an increase in the level of Afadin 6, which in turn is protective for mitochondria. Results obtained by other authors also showed that the park mutation in Drosophila decreases mass and cell size and <BR>increases <BR>sensitivity <BR>to <BR>oxygen <BR>radical <BR>stress <BR>(Pesah <BR>et <BR>al., <BR>2004). <BR>The <BR>overexpression <BR>of <BR>park studied here may also increase cell size and reduce the cell sensitivity to free radicals, which was also a protective effect against rotenone. Results from other authorshaveshownthatoverexpressingthegeneencodingLrrk2, a leucine-rich repeat kinase, also involved in the development of PD, inhibits degeneration of dopaminergic neurons in the Drosophilamodelusingrotenone(Ngetal.,2009).Thisinhibition <BR>suggests that overexpressing genes, the mutation of which cause symptoms of Parkinson’s disease, might be protective against sporadic forms of the disease in animal models exposed to neurotoxins.TheUsp30proteinalsoappearstobeassociatedwith thedevelopmentofParkinson’ssymptoms.Thisproteinislocated in mitochondria and acts as an inhibitor of mitophagy. It has 
Frontiers in Neuroscience | www.frontiersin.org 7 February 2019 | Volume 13 | Article 94 Doktór et al. Mitochondrial Ligases Reverse Rotenon Toxicity 

been shown that overexpressing this protein removes ubiquitin attached by Parkin to damaged mitochondria and blocks the ability <BR>of <BR>Parkin <BR>to <BR>drive <BR>mitophagy <BR>(Bingol <BR>et <BR>al., <BR>2014). We suggest that Usp30 activity is suppressed by the increased levels of Park and Mul1, which restore the correct mitophagy. 
Behavioral disabilities may also result from damaged synapses in the nervous system and neuromotor junctions after exposure to rotenone. We observed that rotenone decreases the level of several proteins associated with synaptic transmission: Dlg1, Synapsin, and Synaptotagmin. Dlg1 is responsible for clustering neurotransmitter receptors and ion channels in the postsynaptic membraneandformediatingcell-celladhesion(Kimetal.,2014). <BR>Synapsinisimportantforvesicleclusteringinthepresynapticsite and <BR>this <BR>protein <BR>also <BR>regulates <BR>synaptic <BR>plasticity <BR>(Vasin <BR>et <BR>al., <BR>2014). <BR>In <BR>turn, <BR>Synaptotagmin <BR>acts <BR>as <BR>a <BR>Ca2+ sensor for fast neurotransmitter <BR>release <BR>(Geppert <BR>et <BR>al., <BR>1994). Low levels of Synapsin or Synaptotagmin lead to poor synaptic transmission and <BR>motor <BR>disorders <BR>in <BR>rats <BR>(Sampedro-Piquero <BR>et <BR>al., <BR>2014; Lai <BR>et <BR>al., <BR>2015). <BR>Moreover, <BR>a <BR>low <BR>level <BR>of <BR>synaptic <BR>proteins <BR>is also correlated with a high level of free radicals, which as described above, reduce the amount of Sod1, increases apoptosis and decreases autophagy. However, the low level of a synaptic protein also results from the weak activity of translational factors of this protein translation, because of the action of free radicals. Lee <BR>et <BR>al. <BR>(Lee <BR>et <BR>al., <BR>2018) have reported that a high level of ROS in human cells affects the activity of eIF2α translation factor. As shown by our results, rotenone decreases the level of proteins, synaptic proteins, Atg5 and Sod1, while the expression of their encoding genes remains normal. In order to confirm the lack of synaptic proteins affects, we conducted a TEM study of tetrad synapses in the first neuropil of the optic lobe of 
D. melanogaster as a model population of synapses. We found that rotenone intoxication affects the morphology of synaptic vesicles as well as the synaptic active zone, which are responsible for neurotransmitter exocytosis into the synaptic cleft. The active zone within the presynaptic T-bar is a site where Ca2+ triggered <BR>fusion <BR>of <BR>a <BR>synaptic <BR>vesicle <BR>occurs <BR>(Wichmann <BR>and <BR>Sigrist, <BR>2010). The proper development of synapses depends on autophagy in Drosophila (Shen <BR>and <BR>Ganetzky, <BR>2009) which is disrupted byrotenoneas well asbeing affected by oxidative stress 
Frontiers in Neuroscience | www.frontiersin.org 8 February 2019 | Volume 13 | Article 94 Doktór et al. Mitochondrial Ligases Reverse Rotenon Toxicity 
(Milton <BR>and <BR>Sweeney, <BR>2012; Kamat <BR>et <BR>al., <BR>2016). <BR>The <BR>observed <BR>changesinsynapsemorphologywerenotobservedinstrainswith mul1 and park overexpression. The T-bar active zones looked normal in both strains, T-bars were large with a large platform, and synaptic vesicles were round, dense in the middle, which is typical for well-functioning synapses. 
Finally, we examined dopaminergic neurons after rotenone exposure in control and mul1 or park overexpression strains. The results of other authors have shown that rotenone at a concentrationof500 µMcausesdegenerationoftheseneuronsin five <BR>clusters:PAL,PPL1, <BR>PPL2, <BR>PPM1/2,and <BR>PPM3 <BR>(Coulom <BR>and <BR>Birman, <BR>2004). These authors did not describe the VUM cluster, but the images included in their article show no reduction of the number of neurons in this group. This was also confirmed in <BR>another <BR>report <BR>(Navarro <BR>et <BR>al., <BR>2014). The decrease of dopaminergic neuron numbers is associated with the reduction of the dopamine level, which is probably associated with motor disability(Smithetal.,2013;Santiagoetal.,2014).Afterrotenone <BR>exposure we observed a decreased number of dopaminergic neurons in the five clusters of neurons previously mentioned, while the overexpression of mitochondrial ligases in neurons of strains fed with rotenone was protective against the toxin and prevented degeneration of the dopamine neurons. Given the association between dopaminergic neurons and motor activity, we propose that the inhibition of their degeneration probably results in the improved climbing ability of Drosophila. 
To conclude, in the present study we showed that rotenone at a concentration of 500 µM reduces the level of autophagy, 
REFERENCES 
Abolaji, A. O., Adedara, A. O., Adie, M. A., Vicente-Crespo, M., and Farombi, 
E. O. (2018). Resveratrol prolongs lifespan and improves 1-methyl-4-phenyl1,2,3,6-tetrahydropyridine-induced oxidative damage and behavioural deficits in Drosophila melanogaster. Biochem. Biophys. Res. Commun. 503, 1042–1048. doi: <BR>10.1016/j.bbrc.2018.06.114 <BR>
Basil, A. H., Sim, J. P. L., Lim, G. G. Y., Lin, S., Chan, H. Y., Engelender, S., et al. (2017). AF-6 protects against dopaminergic dysfunction and mitochondrial abnormalities in Drosophila models of parkinson’s disease. Front. Cell. Neurosci. 11:241. <BR>doi: <BR>10.3389/fncel.2017.00241 <BR>
Betarbet, R., Sherer, T. B., MacKenzie, G., Garcia-Osuna, M., Panov, A. V., and Greenamyre, J. T. (2000). Chronic systemic pesticide exposure reproduces features of parkinson’s disease. Nat. Neurosci. 3, <BR>1301–1306. <BR>doi: <BR>10.1038/8 <BR>1834 <BR>
Bingol, B., Tea, J. S., Phu, L., Reichelt, M., Bakalarski, C. E., Song, Q., et al. (2014). ThemitochondrialdeubiquitinaseUSP30opposesparkin-mediatedmitophagy. Nature 510, <BR>370–375. <BR>doi: <BR>10.1038/nature13418 <BR>
Bunton-Stasyshyn, R. K. A., Saccon, R. A., Fratta, P., and Fisher, E. M. C. (2015). SOD1 function and its implications for amyotrophic lateral sclerosis pathology. Neuroscice 21, <BR>519–529. <BR>doi: <BR>10.1177/1073858414561795 <BR>
Camargo, A., Dalmagro, A. P., Rikel, L., da Silva, E. B., Simão da Silva, K. A. B., and Zeni, A. L. B. (2018). Cholecalciferol counteracts depressive-like behavior and oxidative stress induced by repeated corticosterone treatment in mice. Eur. 
J. Pharmacol. 833, <BR>451–461. <BR>doi: <BR>10.1016/j.ejphar.2018.07.002 <BR>
Chakraborty, J., von Stockum, S., Marchesan,E., Caicci,F., Ferrari, V.,Rakovic, A., etal.(2018).USP14inhibitioncorrectsaninvivomodelofimpairedmitophagy. EMBO Mol. Med. 10:e9014. <BR>doi: <BR>10.15252/emmm.201809014 <BR>
Chen, J.-W., Ni, B.-B., Li, B., Yang, Y.-H., Jiang, S.-D., and Jiang, L.-S. (2014). The responses of autophagy and apoptosis to oxidative stress in nucleus pulposus cells: implications for disc degeneration. Cell. Physiol. Biochem. 34, 1175–1189. doi: <BR>10.1159/000366330 <BR>
apoptosis and increases the level of free radicals. This leads to the disrupted function and morphology of synapses, locomotor activity and dopaminergic neurons in the brain of 
D. melanogaster. We also demonstrated that the overexpression of two main mitochondrial ligases: Mul1 and Park in all neurons is protective, since they inhibit the effect of rotenone. The degeneration of neurons seems to depend not only on the lack of ATP, because of the damaged mitochondria, but also because of their destructive effect in the cell. 
AUTHOR CONTRIBUTIONS 
EP was responsible for funding acquisition, conceptualized the study, administered the project, provided the resources, supervised the study, and also wrote, reviewed and edited the manuscript. BD performed data curation and formal analysis and visualized the study. BD and MD investigated the study and performedthemethodology.MDandEPvalidatedthestudy.BD, MD, and EP wrote the original draft of the manuscript. 
FUNDING 
This study was supported by the Jagiellonian University grant DS 2018 K/ZDS/008070. Funds for open access publication fees was received from the Jagiellonian University (Nr 9000992). 
Clark, I. E., Dodson, M. W., Jiang, C., Cao, J. H., Huh, J. R., Seol, J. H., et al. (2006). Drosophila pink1 is required for mitochondrial function and interacts genetically with parkin. Nature 441, <BR>1162–1166. <BR>doi: <BR>10.1038/nature04779 <BR>
Cornelissen, T., Vilain, S., Vints, K., Gounko, N., Verstreken, P., and Vandenberghe, W. (2018). Deficiency of parkin and PINK1 impairs age-dependent mitophagy in Drosophila. eLife 7:e35878. <BR>doi: <BR>10.7554/eLife.35878 <BR>
Coulom,H., andBirman,S.(2004).Chronicexposuretorotenone modelssporadic parkinson’s disease in Drosophila melanogaster. J. Neurosci. 24, 10993–10998. doi: <BR>10.1523/JNEUROSCI.2993-04.2004 <BR>
Dhanalakshmi, C., Janakiraman, U., Manivasagam, T., Justin Thenmozhi, A., Essa, 
M. M., Kalandar, A., et al. (2016). Vanillin attenuated behavioural impairments, neurochemical deficts, oxidative stress and apoptosis against rotenone induced rat model of parkinson’s disease. Neurochem. Res. 41, <BR>1899–1910. <BR>doi: <BR>10.1007/ <BR>s11064-016-1901-5 <BR>
Duffy, J. B. (2002). GAL4 system in Drosophila: a fly geneticist’s Swiss army knife. Genesis 34, <BR>1–15. <BR>doi: <BR>10.1002/gene.10150 <BR>
Geppert, M., Goda, Y., Hammer, R. E., Li, C., Rosahl, T. W., Stevens, C. F., et al. (1994). Synaptotagmin I: a major Ca2+ sensor for transmitter release at a central synapse. Cell 79, <BR>717–727. <BR>doi: <BR>10.1016/0092-8674(94)90556-8 <BR>
Gokcal, E., Gur, V. E., Selvitop, R., Babacan Yildiz, G., and Asil, T. (2017). Motor andnon-motorsymptoms inparkinson’s disease: effectsonqualityoflife. Noro. Psikiyatr. Ars. 54, <BR>143–148. <BR>doi: <BR>10.5152/npa.2016.12758 <BR>
Henchcliffe, C., and Beal, M. F. (2008). Mitochondrial biology and oxidative stress in parkinson disease pathogenesis. Nat. Clin. Pract. Neurol. 4, 600–609. doi: <BR>10.1038/ncpneuro0924 <BR>
Kamat, P. K., Kalani, A., Rai, S., Swarnkar, S., Tota, S., Nath, C., et al. (2016). Mechanism of oxidative stress and synapse dysfunction in the pathogenesis of alzheimer’s disease: understanding the therapeutics strategies. Mol. Neurobiol. 53, <BR>648–661. <BR>doi: <BR>10.1007/s12035-014-9053-6 <BR>
Kehrer, J. P., and Klotz, L.-O. (2015). Free radicals and related reactive species as mediatorsoftissueinjuryanddisease:implicationsforhealth. Crit.Rev.Toxicol. 45, <BR>765–798. <BR>doi: <BR>10.3109/10408444.2015.1074159 <BR>
Frontiers in Neuroscience | www.frontiersin.org 9 February 2019 | Volume 13 | Article 94 Doktór et al. Mitochondrial Ligases Reverse Rotenon Toxicity 
Kim, S. T., Ahn, S.-Y., Swat, W., and Miner, J. H. (2014). DLG1 influences distal ureter maturation via a non-epithelial cell autonomous mechanism involving reduced retinoic acid signaling, ret expression, and apoptosis. Dev. Biol. 390, 160–169. <BR>doi: <BR>10.1016/j.ydbio.2014.03.014 <BR>
Kitada, T., Asakawa, S., Hattori, N., Matsumine, H., Yamamura, Y., Minoshima, S., et al. (1998). Mutations in the parkin gene cause autosomal recessive juvenile parkinsonism. Nature 392, <BR>605–608. <BR>doi: <BR>10.1038/33416 <BR>
Koentjoro, B., Park, J.-S., and Sue, C. M. (2017). Nix restores mitophagy and mitochondrial function to protect against PINK1/Parkin-related parkinson’s disease. Sci. Rep. 7:44373. <BR>doi: <BR>10.1038/srep44373 <BR>
Kuma, A., Hatano, M., Matsui, M., Yamamoto, A., Nakaya, H., Yoshimori, T., et al. (2004). The role of autophagy during the early neonatal starvation period. Nature 432, <BR>1032–1036. <BR>doi: <BR>10.1038/nature03029 <BR>
Lai,Y.,Lou,X.,Diao,J.,andShin,Y.-K.(2015).Molecularoriginsofsynaptotagmin 1 activities on vesicle docking and fusion pore opening. Sci. Rep. 5:9267. <BR>doi: <BR>10.1038/srep09267 <BR>
Lee, I. C., Ho, X. Y., George, S. E., Goh, C. W., Sundaram, J. R., Pang, K. K. L., et al. (2018). Oxidative stress promotes SIRT1 recruitment to the GADD34/PP1α complex to activate its deacetylase function. Cell Death Differ. 25, 255–267. doi: <BR>10.1038/cdd.2017.152 <BR>
Li, D.-Y., Yu, J.-C., Xiao, L., Miao, W., Ji, K., Wang, S.-C., et al. (2017). Autophagy attenuates the oxidative stress-induced apoptosis of Mc3T3-E1 osteoblasts. Eur. Rev. Med. Pharmacol. Sci. 21, <BR>5548–5556. <BR>doi: <BR>10.26355/eurrev_201712_1 <BR>3991 <BR>
Lindahl,P.E., andÖberg,K.E.(1961).The effectofrotenoneonrespirationandits point of attack. Exp. Cell Res. 23, <BR>228–237. <BR>doi: <BR>10.1016/0014-4827(61)90033-7 <BR>
Milton, V. J., and Sweeney, S. T. (2012). Oxidative stress in synapse development and function. Dev. Neurobiol. 72, <BR>100–110. <BR>doi: <BR>10.1002/dneu. <BR>20957 <BR>
Nagoshi, E. (2018). Drosophila models of sporadic parkinson’s disease. Int. J. Mol. Sci. 11:E3343. <BR>doi: <BR>10.3390/ijms19113343 <BR>
Nässel, D. R., and Elekes, K. (1992). Aminergic neurons in the brain of blowflies andDrosophila:dopamine-andtyrosinehydroxylase-immunoreactiveneurons and their relationship with putative histaminergic neurons. Cell Tissue Res. 267, 147–167. <BR>doi: <BR>10.1007/BF00318701 <BR>
Navarro, J. A., Heßner, S., Yenisetti, S. C., Bayersdorfer, F., Zhang, L., Voigt, A., et al. (2014). Analysis of dopaminergic neuronal dysfunction in genetic and toxin-induced models of parkinson’s disease in Drosophila. J. Neurochem. 131, 369–382. <BR>doi: <BR>10.1111/jnc.12818 <BR>
Navarro-Yepes, J., Burns, M., Anandhan, A., Khalimonchuk, O., del Razo, L. M., Quintanilla-Vega, B., et al. (2014). Oxidative stress, redox signaling, and autophagy: cell death versus survival. Antioxid. Redox Signal. 21, 66–85. doi: <BR>10.1089/ars.2014.5837 <BR>
Ng, C.-H., Mok, S. Z. S., Koh, C., Ouyang, X., Fivaz, M. L., Tan, E.-K., et al. (2009). Parkin protects against LRRK2 G2019S mutant-induced dopaminergic neurodegeneration in Drosophila. J. Neurosci. 29, <BR>11257–11262. <BR>doi: <BR>10.1523/ <BR>JNEUROSCI.2375-09.2009 <BR>
Park, J., Lee, S. B., Lee, S., Kim, Y., Song, S., Kim, S., et al. (2006). Mitochondrial dysfunction in Drosophila PINK1 mutants is complemented by parkin. Nature 441, <BR>1157–1161. <BR>doi: <BR>10.1038/nature04788 <BR>
Pech, U., Pooryasin, A., Birman, S., and Fiala, A. (2013). Localization of the contacts between kenyon cells and aminergic neurons in the Drosophila melanogaster brain using splitGFP reconstitution. J. Comp. Neurol. 521, 3992–4026. <BR>doi: <BR>10.1002/cne.23388 <BR>
Pesah, Y., Pham, T., Burgess, H., Middlebrooks, B., Verstreken, P., Zhou, Y., et al. (2004). Drosophila parkin mutants have decreased mass and cell size and increased sensitivity to oxygen radical stress. Development 131, 2183–2194. doi: <BR>10.1242/dev.01095 <BR>
Rosato, E., and Kyriacou, C. P. (2006). Analysis of locomotor activity rhythms in Drosophila. Nat. Protoc. 1, <BR>559–568. <BR>doi: <BR>10.1038/nprot.2006.79 <BR>
Rosiñczuk, J., Dymarek, R., and Całkosiñski, I. (2018). The protective action of tocopherol and acetylsalicylic acid on the behavior of rats treated with dioxins. Adv. Clin. Exp. Med. 27, <BR>5–14. <BR>doi: <BR>10.17219/acem/67314 <BR>
Sampedro-Piquero,P.,Arias,J.L.,andBegega,A.(2014).Behavioraltesting-related changesintheexpressionofsynapsinIandglucocorticoidreceptorsinstandard and enriched aged wistar rats. Exp. Gerontol. 58, <BR>292–302. <BR>doi: <BR>10.1016/j.exger. <BR>2014.09.004 <BR>
Santiago, R. M., Barbiero, J., Gradowski, R. W., Bochen, S., Lima, M. M. S., Da Cunha, C., et al. (2014). Induction of depressive-like behavior by intranigral 6OHDAisdirectlycorrelatedwithdeficitsinstriataldopamineandhippocampal serotonin. Behav. Brain Res. 259, <BR>70–77. <BR>doi: <BR>10.1016/j.bbr.2013.10.035 <BR>
Sena,L.A.,andChandel,N.S.(2012).Physiologicalrolesofmitochondrial reactive oxygen species. Mol. Cell 48, <BR>158–167. <BR>doi: <BR>10.1016/j.molcel.2012.09.025 <BR>
Shen, W., and Ganetzky, B. (2009). Autophagy promotes synapse development in Drosophila. J. Cell Biol. 187, <BR>71–79. <BR>doi: <BR>10.1083/jcb.200907109 <BR>
Silva, J. P., and Coutinho, O. P. (2010). Free radicals in the regulation of damage andcelldeathbasicmechanismsandprevention.DrugDiscov.Ther.4,144–167. 
Smith, E. S., Geissler, S. A., Schallert, T., and Lee, H. J. (2013). The role of central amygdaladopamineindisengagementbehavior. Behav. Neurosci. 127,164–174. doi: <BR>10.1037/a0031043 <BR>
Sun, L., Hao, Y., An, R., Li, H., Xi, C., and Shen, G. (2014). Overexpression of Rcan1-1L inhibits hypoxia-induced cell apoptosis through induction of mitophagy. Mol. Cells 37, <BR>785–794. <BR>doi: <BR>10.14348/molcells.2014.0103 <BR>
Trevisan,T.,Pendin,D.,Montagna,A.,Bova,S.,Ghelli,A.M.,andDaga,A.(2018). Manipulation of mitochondria dynamics reveals separate roles for form and function in mitochondria distribution. Cell Rep. 23, <BR>1742–1753. <BR>doi: <BR>10.1016/ <BR>j.celrep.2018.04.017 <BR>
Vasin, A., Zueva, L., Torrez, C., Volfson, D., Littleton, J. T., and Bykhovskaia, M. (2014). Synapsin regulates activity-dependent outgrowth of synaptic boutons at the drosophila neuromuscular junction. J. Neurosci. 34, 10554–10563. doi: <BR>10.1523/JNEUROSCI.5074-13.2014 <BR>
Wichmann, C., and Sigrist, S. J. (2010). The active zone t-bar—a plasticity module? 
J. Neurogenet. 24, <BR>133–145. <BR>doi: <BR>10.3109/01677063.2010.489626 <BR>
Wise, J. P., Price, C. G., Amaro, J. A., Cannon, J. R., and Cannon, J. R. (2018). Autophagy disruptions associated with altered optineurin expression in extranigral regions in a rotenone model of parkinson’s disease. Front. Neurosci. 
12:289. doi: <BR>10.3389/fnins.2018.00289 <BR>
Xu, D., Woodfield, S. E., Lee, T. V., Fan, Y., Antonio, C., and Bergmann, A. (2009). Genetic control of programmed cell death (apoptosis) in Drosophila. Fly 3, 78–90. <BR>doi: <BR>10.4161/fly.3.1.7800 <BR>
Youle, R. J., and Narendra, D. P. (2011). Mechanisms of mitophagy. Nat. Rev. Mol. Cell Biol. 12, <BR>9–14. <BR>doi: <BR>10.1038/nrm3028 <BR>
Yun, J., Puri, R., Yang, H., Lizzio, M. A., Wu, C., Sheng, Z.-H., et al. (2014). MUL1 acts in parallel to the PINK1/parkin pathway in regulating mitofusin and compensates for loss of PINK1/parkin. eLife 3:e01958. <BR>doi: <BR>10.7554/eLife. <BR>01958 <BR>
Zilocchi, M., Finzi, G., Lualdi, M., Sessa, F., Fasano, M., and Alberio, T. (2018). Mitochondrial alterations in parkinson’s disease human samples and cellular models. Neurochem. Int. 118, <BR>61–72. <BR>doi: <BR>10.1016/J.NEUINT.2018.04.013 <BR>
Conflict of Interest Statement: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. 
Copyright © 2019 Doktór, Damulewicz and Pyza. This is an open-access article distributed <BR>under <BR>the <BR>terms <BR>of <BR>the <BR>Creative <BR>Commons <BR>Attribution <BR>License <BR>(CC <BR>BY). <BR>The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publicationinthisjournaliscited,inaccordancewithacceptedacademicpractice.No use,distributionorreproductionispermittedwhichdoesnotcomplywiththeseterms. 
Frontiers in Neuroscience | www.frontiersin.org 10 February 2019 | Volume 13 | Article 94 
RESEARCH PAPER 
Acta Neurobiol Exp 2018, 78: 231–241 DOI: 10.21307/ane‑2018‑021 
Effects of PINK1 mutation on synapses and behavior in the brain of Drosophila melanogaster 
Bartosz Doktór, Milena Damulewicz, Wojciech Krzeptowski, Barbara Bednarczyk and Elżbieta Pyza* 
Department of Cell Biology and Imaging, Institute of Zoology and Biomedical Research, Jagiellonian University, Kraków, Poland, 
* Email: elzbieta.pyza@uj.edu.pl 
Mutations in the PINK1 gene are responsible for typical symptoms of Parkinson’s disease. Using Drosophila melanogaster mutant PINK1B9 and after PINK1 silencing with RNAi using transgenic lines, we observed defects in synapses and behavior. The lack or reduced expression of PINK1 prolonged sleep during the day (nap) and decreased the total locomotor activity during 24 h, in addition to a decrease in climbing ability and a reduced lifespan. In the brain, PINK1 mutants had a lower level of Bruchpilot (BRP), a presynaptic scaffolding protein that is crucial for neurotransmission in all type of synapses in Drosophila. In addition, other proteins that are involved in synaptic transmission; Rab5, Syntaxin and Wishful Thinking were also decreased in abundance in mutants, except Synaptotagmin. Transmission electron microscopy (TEM) also confirmed less and abnormal synaptic vesicles at tetrad synapses in the visual system of PINK1 mutants. The lower level of BRP and longer day sleep observed was also detected in white mutants, which were examined to test the effect of the white background on the PINK1B9 strain. The reduced locomotor activity and longer day sleep in PINK1 mutants and after decreasing the 
PINK1 level in neurons seem to be correlated with a decrease in mitochondria number during the day, when they normally peak, and 
with impaired synaptic transmission. 
Key words: Parkinson’s disease, Bruchpilot, Rab5, Syntaxin, Synaptotagmin, Wishful Thinking, white gene, motor activity, circadian rhythm, sleep, synaptic plasticity, mitochondria 
INTRODUCTION 

Parkinson’s disease (PD) is one of the most common neurodegenerative disorders characterized by de‑generation of dopaminergic neurons in the substantia nigra of the brain. PD, the familial form, is caused by mutations in ~150 genes while the sporadic form can be induced by exposure to toxins. One of the common mutations observed in the familiar form of PD is mutation in the PINK1 (PARK6) gene, which encodes PTEN‑induced putative kinase 1 (PINK1). In normal cells PINK1 accumulates on the surface of damaged mitochondria and together with the E3 ubiquitin ligase PARKIN, initiates mitophagy, a process of autophagy of damaged mitochondria (Matsuda et al. 2010). PINK1 contains an N‑terminal mitochondrial targeting sequence (MTS), a transmembrane sequence (TMS), and a Ser/Thr kinase domain located at the C‑terminus (Eiyama and Okamoto 2015). Under normal conditions PINK1 is translocated to the mitochondrial membrane, where MTS is cleaved by the mitochondrial processing peptidase (MPP) (Greene et al. 2012), and the TMS by Presenilin‑associated rhomboid‑like protein (PARL) (Deas et al. 2011). PINK1 without the MTS and TMS domains is transferred to the cytoplasm, where it is degraded mainly by the ubiquitin‑proteasome system (Yamano and Youle 2013). When mitochondria are damaged, they do not maintain the inner membrane potential, and in effect the MTS and TMS cannot be cleaved and PINK1 is stabilized on the outer mitochondrial mem‑brane (OMM) (Lazarou et al. 2012). After PINK1 attachment to the translocase complex of the mitochondrial outer membrane (TOM), it phosphorylates PARKIN, which causes its activation and recruitment into the OMM (Chen and Dorn 2013). In the next step, PINK1, to‑
Received 20 April 2017, accepted 7 June 2018 
232 B. Doktór et al. 
gether with PARKIN, targets mitofusins located on the mitochondrial surface for proteasomal degradation, leading to whole organellum degradation (Thomas et al. 2014). During PD, in the result of the PINK1 mutation, damaged and old mitochondria, which are the source of high amounts of free radicals, cannot be degraded and thus they cause dysfunction or death of neurons. The most sensitive structures to malfunctioning mitochondria are synapses, because of the high energy requirement for synaptic transmission. Mitochondria provide ATP for the formation and transport of synaptic vesicles and for neurotransmitter exocytosis. Moreover, mitochondria are involved in uptake and release of calcium ions (Ly and Verstreken 2006), which regulate release of neurotransmitters from synaptic vesicles to the synaptic cleft. Disorders in calcium release from mitochondria and in ATP production affect motor and cognitive functions, similar to those observed in PD. 
Various aspects of PD and other neurodegenerative diseases are often studied using the fruit fly, Drosophila melanogaster, as a model organism. Molecular and behavioral disorders in the Drosophila model of PD are similar to those observed in mammalian PD models (Feany and Bender 2000, Lu and Vogel 2009). In Drosophila PINK1 is involved in the mitochondrial fission/ fusion process and PINK1 mutants have already been described (Yang et al. 2006). Mutations in PINK1 cause inhibition of mitochondrial fission and in result the appearance of large and swollen mitochondria (Poole et al. 2008). One of the substrates of PINK1 is mitofusin (Mfn), a protein responsible for mitochondrial fusion. PINK1 with PARKIN directs Mfn to the degradation pathway and thus it contributes to the process of mitochondrial fission (Ziviani et al. 2010). Mutation of PINK1 results in reduced production of ATP (Park et al. 2006), indirect flight muscle degradation (Yang et al. 2006) and disorders in the locomotor activity of flies. In addition, PINK1 mutation causes degeneration of dopaminergic neurons (Wang et al. 2006), a marker of Parkinson’s disease, abnormal synaptic transmission and accumulation of synaptic vesicles (Morais et al. 2009). 
One of the most important proteins involved in synaptic transmission in Drosophila is the presynaptic protein Bruchpilot (BRP) (Kittel et al. 2006). BRP is the human homolog of ELKS/CAST/ERC [CAST ‑ cytoskeletal matrix associated with the active zone (CAZ)‑associated structural protein, also called ERC (ELKS, Rab6‑interacting protein 2, and CAST)] proteins and it is responsible for the accumulation of calcium channels in the active zone and release of neurotransmitter. BRP is expressed in all synapses as two subunits BRP190 and BRP170 (Wagh et al. 2006). It has been shown that a reduced level of BRP results in motor disorders (Wagh et al. 2006) similar to that present in flies with muta‑
Acta Neurobiol Exp 2018, 78: 231–241 

tions causing PD symptoms. Besides BRP other proteins such as Rab5, Syntaxin, Synaptotagmin and Wishful Thinking (WIT) are crucial for synaptic transmission. Rab5 is a major protein that mediates membrane trafficking with the specialized early endosome domain. Rab5 takes part in synaptic vesicle maturation during synaptic transmission (Hoop et al. 1994, Stenmark 2009, Wucherpfennig et al. 2003). Wucherpfennig et al. (2003) reported that lack of Rab5 causes locomotor defects, abnormal morphology of synaptic terminals and a reduced size of synaptic vesicles. Syntaxin protein is involved in synaptic vesicle fusion in the presynaptic active zones and it mediates exocytosis (Sieber et al. 2006, Ullrich et al. 2015). In turn Synaptotagmin is an essential protein for the release of neurotransmitter into the synaptic cleft because it binds Ca2+ that triggers vesicle fusion (Geppert et al. 1994, Shields et al. 2017). WIT regulates synaptic growth, the number of active zones in presynaptic elements and maintains the amplitude of excitatory junction potentials (Aberle et al. 2002). 
In our present study, we found a correlation between the level of BRP protein and motor disorders caused by PINK1 mutation. We showed that PINK1 mutants have less BRP and all other proteins studied, except Synaptotagmin. In addition, the PINK1 mutation affects sleep, increasing sleep during the day (nap), which leads to a decrease of total activity during 24 h. 
METHODS 

Animals 
The following strains were used for the experiments: Canton S, w1118 (null mutation of the gene white encoding the ABC transporter) (Krstic et al. 2013), PINK1B9 (point deletion of the gene encoding PINK1 kinase) (Park et al. 2006), elav‑GAL4 (expressing the yeast transcription factor GAL4 under control of the elav promoter) (DiAntonio et al. 2001), 21D‑GAL4 (expressing the yeast transcription factor GAL4 in L2 neurons of the lamina, the first optic neuropil) (Weber et al. 2009), UAS‑Valium10 (expressing GFP and Valium under UAS control) (Ni et al. 2009), UAS‑PINK1RNAi (expressing interfering RNA for PINK1) (Yang et al. 2006) and UAS‑mitoGFP (expressing GFP with a mitochondrial import signal) (Pilling et al. 2006). 
Since the strain PINK1B9 used in our experiments has the white background, which may affect results, we used white mutants as a control in addition to wild type flies Canton S, and a strain with PINK1 RNAi expressed in neurons (elav‑GAL4>UAS‑PINK1RNAi) to decrease the level of PINK1 in neurons. The White gene encodes 
Acta Neurobiol Exp 2018, 78: 231–241 
the ABC transporter that is one of the most important membrane transporters (Ewart et al. 1994) and is involved in many physiological processes. As a control for the RNAi strain (elav‑GAL4>UAS‑PINK1RNAi) we used elav‑GAL4>UAS‑Valium10. The level of gene expression silencing in the elav‑GAL4>UAS‑PINK1RNAi strain was equal to 74%. 
Transgenic strains were obtained from the Bloomington Drosophila Stock Center. Flies were maintained on a standard yeast‑cornmeal‑agar medium at 25 ± 1°C, under a day/night cycle (12 h of light and 12 h of darkness; LD 12:12). To downregulate PINK1 expression in neurons, elav‑GAL4 females were crossed to UAS‑PINK1RNAi males and elav‑GAL4 females were also crossed to UAS‑Valium10 males to express the VALIUM vector in neurons as the control in the RNAi experiments (Ni et al. 2009). To visualize mitochondria in the L2 cells of the first optic neuropil (lamina) of the optic lobe 21D‑GAL4 females were crossed to UAS‑mitoGFP males. 
Locomotor activity and sleep analysis 
Males, 1–2 days old (N=32), were transferred to small glass tubes containing the sugar‑agar food medium. Vials were located in DAMS monitors (Drosophila Activity Monitoring System, TriKinetics) and placed in an incubator (25°C). Monitors were equipped with infrared sensors, which recorded the activity of the flies inside the vials every 5 min. For the first 5 days, monitors were held in LD 12:12 (12 h of light and 12 h of darkness) conditions and then for 6 days in constant darkness (DD). Results from the second day of recording were analyzed to estimate the total activity and duration of sleep during the day and during the night [(Microsoft Excel plugin – Be‑Fly kindly donated by E. Green from Genetics, University of Leicester) (Rosato and Kyriacou 2006) and Python 22 (http://www.python.org/)]. Sleep in flies is defined as time in which they do not change their position for at least 5 min. The experiment was repeated three times. In LD 12:12 and DD the rhythm of locomotor activity was also examined, and the period of the circadian locomotor activity rhythm was measured in DD. 
Immunohistochemistry 
Males, 7 and 35 days old, were decapitated at four times points: 1 h after lights‑on (ZT1), 4 h after lights‑on (ZT4), 1 h after lights‑off (ZT13) and 4 h after lights‑off (ZT16). Heads were fixed in 4% paraformaldehyde in phosphate buffer saline (PBS; pH 7.4) for 3 h at 4°C. Next, they were washed in PBS two times for 10 min and then cryoprotected by incubation in 12.5% 
PINK1 mutation affects synapses and behavior 233 

sucrose for 10 min and 25% sucrose overnight at 4°C. Heads were then embedded in Tissue‑Tek (Thermo Scientific, frozen medium), frozen in liquid nitrogen and 20 nm cryostat sections were cut. Sections were washed in PBS for 30 min, then washed two times in phosphate buffer with added 0.2% Triton X 100 (PBT) for 10 min, once in 2% PBT for 5 min and three times in 0.5% PBT for 5 min. Next, they were incubated in 5% Normal Goat Serum (NGS) in 0.5% Bovine Serum Albumin (BSA) for 30 min at room temperature. Subsequently sections were incubated with primary antibodies mouse nc82 against Bruchpilot protein, diluted 
1:20 (Developmental Studies Hybridoma Bank) in 2% NGS in 0.5% PBT for 3 days at 4°C, or with rabbit an‑ti‑GFP antibodies (Novus Biologicals) diluted 1:1000 in 2% NGS in 0.5% PBT for 1 day at 4°C. Afterwards sections were washed six times in 0.2% BSA in 0.2% PBT for 5 min, blocked in 5% NGS in 0.2% BSA for 30 min and incubated overnight at 4°C with secondary antibodies [Cy3 conjugated goat anti‑mouse antibodies (Jackson Immuno Research) diluted 1:500 or Alexa488 conjugated goat anti‑rabbit antibodies (MolecularProbes) diluted 1:1000, respectively]. After the incubation, sections were washed twice in 0.2% BSA in 0.2% PBT for 10 min, six times in 0.2% PBT for 5 min and twice in PBS for 10 min. Finally, they were mounted in Vectashield medium (Vector) and examined with a Zeiss Meta 510 Laser Scanning Microscope or Zeiss Axio Imager M2 fluorescence microscope. 
Quantification of Immunolabeling 
To measure the fluorescence intensity of BRP in the first optic neuropil (lamina) of the Drosophila optic lobe, we used confocal images of the lamina cross sections. We used the lamina because in our earlier studies we found that in this optic neuropil, tetrad synapses formed between the eye photoreceptor terminals and lamina cells, oscillate during the day and night (Pyza and Meinertzhagen 1993, Woznicka et al. 2015) and this rhythm is correlated with the circadian changes of BRP in tetrad synapses (Górska‑Andrzejak et al. 2013). For the present study, we randomly selected 5–10 distal cartridges (the second and third row of cartridges from the lamina cortex) where BRP can be measured in tetrad synapses and measured the fluorescence intensity with ImageJ software (NIH, Bethesda). In the distal lamina tetrad, synapses outnumber other synapse types in the lamina (Meinertzhagn and O’Neil 1999). The fluorescence intensity of images was converted to gray values and the mean gray value (the sum of the gray values of all pixels in the area divided by the number of pixels within the selection) was calculated. Results from one 
234 B. Doktór et al. Acta Neurobiol Exp 2018, 78: 231–241 
head were averaged and a background signal was subtracted. For each strain 15–25 measurements were collected, and the experiment was repeated three times. 
The fluorescence intensity of the GFP‑labeled mitochondria was measured from images of longitudinal sections of the lamina neuropil. The intensity of 2 random areas of the lamina neuropil was analyzed by ImageJ software as described above and results from one head were averaged. The experiment was repeated three times. 
Western Blot 
Males, 7 days old (N=30), were frozen in liquid nitrogen 1 h after lights‑on and decapitated. Heads were homogenized by sonication in 30 µl of Laemmli buffer with protease inhibitor (Boehringer, Mannheim). Homogenates of heads were incubated for 30 min at 4°C and frozen at ‑20°C until centrifugation. The homogenates were centrifuged at 13,200 rpm for 1 h at 4°C. Supernatants were collected and denatured at 85°C for 5 min. Total protein level was measured by Quant‑iT Protein Assay Kit and Qubit fluorometer (Invitrogen). Afterwards, 20 µg of protein from each supernatant was subjected to electrophoresis (NuPAGE 4–12% bis‑Tris gels, Invitrogen) at 165 V for 40 min and then blotted by electrotransfer onto a PVDF membrane (Invitrogen) at 30 V for 60 min. The membrane was blocked in 5% non‑fat dry milk in PBS with 0.1% Tween 20 (TBS) for 1 h at 4°C and incubated with primary antibodies; an‑ti‑BRP (nc82, dilution 1:1000) and anti‑α tubulin (dilution 1:20000), anti‑WIT (23C7, dilution 1:1000), an‑ti‑Synaptotagmin (3H2 2D7, dilution 1:2), anti‑Syntaxin (8C3, dilution 1:1000) from the Developmental Studies Hybridoma Bank, and anti‑Rab5 (diluted 1:1000, Abcam) in 1% BSA in 0.1% TBS overnight at 4°C. Next, the membrane was washed 5 times in 0.1% TBS for 10 min and incubated with the secondary antibody conjugated with HRP (dilution 1:10000, Abcam) in 1% BSA in 0.1% TBS for 1 h at room temperature. After this the incubation membrane was washed 5 times in 0.1% TBS and immunodetected with the ECL detection system (Perkin Elmer). Densitometric analysis of Western Blots was performed by ImageJ. The experiment was repeated three times. 

Fig. 1. PINK1 mutation and PINK1 RNAi in neurons cause locomotor activity impairment. (A) and (B) Total activity from the second day of locomotor activity recording in LD 12: 12 conditions (12 h of light and 12 h of darkness). Charts show time of total activity in minutes for each genotype. (A): the total activity time was the lowest in PINK1 mutants in comparing with white mutants and wild type Canton S. (B): flies with silenced PINK1 in neurons had also reduced activity when compared with the control (four stars represent p<0.01, one star represents p<0.05) (B). (C) and (D) Sleep duration in the day/light phase of LD 12: 12 conditions. PINK1B9 and w1118 flies had prolonged day sleep (nap) (one star represents p<0.05) in comparing with wild type strain (C). Flies with silenced PINK1 in neurons also exhibited longer sleep during the day than control flies (four stars represent p<0.01) (D). (E) and (F) Sleep duration in the night/dark phase of the second day of LD 12: 12 conditions. PINK1B9, w1118 and Canton S had the same sleep duration during the night (E). The duration of sleep at night did not change also in elav‑GAL4>UAS‑PINK1RNAi flies (F). 
Acta Neurobiol Exp 2018, 78: 231–241 PINK1 mutation affects synapses and behavior 235 
Transmission Electron Microscopy (TEM) 
Heads of 1‑week old males were dissected one hour after lights‑on and fixed in cacodyl‑buffered PFA (2.5%) and glutaraldehyde (2%) primary fixative for 2 h. They were post‑fixed in OsO4 (2%) in veronal acetate buffer for 1 h. Subsequently, the heads were dehydrated in a series of alcohols and propylene oxide and embedded in Poly/ Bed 812 resin (Polysciences). Ultrathin sections (65 nm thick) of the lamina were cut and contrasted with uranyl acetate and lead citrate. Images of tetrad synapses in the lamina were taken using a Jeol JEM 2100 HT TEM. The experiment was repeated 3 times. 10 images were taken per 1 repetition. 
Statistics 
The statistical analyses were performed using Graph‑Pad Prism 6. Data were examined for distribution normality, and statistical tests were chosen accordingly. For lifespan results the Kaplan‑Meier test was used. The Wilcoxon–Mann–Whitney and Kruskal–Wallis tests were performed to assess differences in the fluorescence intensity correlated with BRP protein levels from confocal images, GFP fluorescence intensity of mitochondria, sleep, total activity, period of the circadian rhythm of locomotor activity and for climbing assays. For Western Blot data the one‑way ANOVA and Tukey tests were used. 
RESULTS 

The effect of PINK1 on locomotor activity 
Recordings of flies’ locomotor activity showed that the activity level during 24 h of PINK1B9 was lower when compared with w1118 and Canton S (Fig. 1A). The activity of PINK1 RNAi flies was also lower than the control Valium10 (Fig. 1B). Sleep in both PINK1B9 and w1118 flies was increased but only during the day (Fig. 1C). Similar results were also obtained in flies with PINK1 RNAi, which exhibited longer sleep during the day (Fig. 1D), whereas sleep during the night was unchanged (Fig. 1E, F). 
The effect of PINK mutation on synapses 
BRP level, measured as the fluorescence intensity after immunolabeling in the lamina at ZT1 (Fig. 3A‑C) 

Fig. 2. PINK1 and white mutations are responsible for the reduced Bruchpilot (BRP) level in tetrad synapses in the lamina. (A‑E) Immunolabeling of BRP in tetrad synapses of the examined strains with nc82 antibodies. Reaction was carried out in the lamina sections of flies collected at ZT1 (one hour after lights‑on). Scale bar – 20 µm. (F) and (G) The fluorescence index of BRP. Charts show the fluorescent intensity correlated with BRP level. Statistically significant differences (four stars and a,b,c represent p<0.05) are between all genotypes in both (F) and (G) charts. PINK1B9 and elav‑GAL4>UAS‑PINK1RNAi had lower level of BRP in tetrad synapses in comparing with other strain studied. 
236 B. Doktór et al. Acta Neurobiol Exp 2018, 78: 231–241 
was the lowest in PINK1B9 flies (Fig. 2B), however, it was also lower in the white mutation in comparison with Canton S Flies and with silenced PINK1 in neurons there was also a reduced BRP level in the lamina (Fig. 2G). In contrast, the daily rhythm of the BRP level in tetrad synapses, with two peaks at ZT1 and ZT13, was not changed in both mutants; PINK1B9 and w1118, in comparison with Canton S flies. 
The reduced level of BRP was also detected in the whole brains of the studied flies. Western Blot analysis showed a lower level of both BRP isoforms BRP170 and BRP190 in PINK1B9 and elav‑GAL4>UAS‑PINK1RNAi (Fig. 3A‑C) when compared with the controls Canton S and elav‑GAL4>UAS‑Valium10, respectively. BRP level in w1118 was also lower than in Canton S but this reduction was not statistically significant. The daily rhythm in changes of the BRP level was not affected by aging. Moreover, the BRP level at ZT1 was similar in young (7 days old) and older (35 days old) flies of the Canton S and other strains studied: w1118, PINK1B9 and elav‑GAL4>UAS‑PINK1RNAi. 
PINK1 mutants also exhibited reduced levels of other proteins involved in synaptic transmission. In these mutants, the levels of Syntaxin and Rab5 were lower when compared with the controls Canton S and 
w1118
 (Fig. 4A‑B). The abundance of Wishful Thinking (WIT) was also lower compared with the control w1118 (Fig. 4C), in contrast to Synaptotagmin, where the level was similar in all genotypes studied (Fig. 4D). Moreover, morphology of the synaptic vesicles studied in tetrad synapses in the visual system in PINK1 mutants was changed when compared with white and Canton S controls (Fig. 5). The synaptic vesicles of PINK1 mutants had broken membranes and most of them were darker (higher electronic density) compared with the control strains and their number was reduced (Fig. 5). 
Daily oscillations of mitochondria number in the first optic neuropil 
Since sleep in the mutant studied was affected only during the day we also measured daily changes in mitochondria number in neurons. We selected L2 interneurons of the lamina, one of the four postsynaptic cells in tetrad synapses and analyzed the fluorescence intensity of GFP‑labeled mitochondria in L2 (Fig. 6A) at different time points. The obtained results showed a significantly higher signal during the day (ZT1 and ZT4) than during the night (ZT13 and ZT16) (Fig. 6B). This means that the number of mitochondria increases during the day, when insects are more active in locomotor activity, rather than during the night. Their number is not correlated with the two peaks, at ZT1 and ZT13, in the 

Fig. 3. PINK1 and white mutations are responsible for the reduced Bruchpilot (BRP) level in the brain. (A) and (B) Densitometric analysis of BRP190 and BRP170 isoforms in Canton S, PINK1B9, w1118 (A), elav‑GAL4>UAS‑Valium and elav‑GAL4>UAS‑PINK1RNAi (B). BRP level was standardized to Canton S and elav‑GAL4>UAS‑Valium in (A) and (B), respectively. Statistically significant differences (four stars represent p<0.01, and one star represents p=0.05) are between PINK1B9 and Canton S and between elav‑GAL4>UAS‑PINK1RNAi and Valium controls. (C) Result of Western Blot of BRP in whole brain homogenates of all genotype studied. 
Acta Neurobiol Exp 2018, 78: 231–241 
number of tetrad synapses with postsynaptic elements that are also in L2 interneurons. 
DISCUSSION 

The malfunction of Mitochondrial Complex I, oxidative stress and aggregation of abnormal/misfolded proteins are typical molecular symptoms of Parkinson’s disease (PD) (Dawson and Dawson 2003). They lead to a decrease in mitochondria number, and the lack of energy may be responsible for subsequent neurodegeneration (Li et al. 2017), thus this may be correlated with the observed motor and non‑motor disorders in PD. It was previously shown that in PINK1 mutants the level of ATP is low, indicating dysfunction of mitochondria (Liu et al. 2011). In the present study, we found that PINK1 mutation causes not only motor disorders and reduced activity but also affect synapses and synaptic transmission in the brain and neuromuscular junctions. Mo
PINK1 mutation affects synapses and behavior 237 

tor disorders have already been reported in PD animal models (Feany and Bender 2000). Moreover, in PINK1 mutants of Drosophila morphological abnormalities of indirect flight muscles (Park et al. 2006) and apoptosis of muscle cells have been observed (Clark et al. 2006). 
As reported by other authors both mutations also affect lifespan and the climbing ability of flies, which were both decreased (data not shown). In the present study we showed that in addition both PINK1 and white mutants have abnormal sleep and their total activity is decreased. The duration of sleep was lengthened during the day but not during the night in comparison with wild type Canton S flies, and in addition, total activity was decreased in PINK1 mutants. Longer sleep during the day shortens time for living functions and behavior in Drosophila, which are concentrated during the day and at the beginning of the night. The effect of PINK1 mutation on sleep and daily activity was also confirmed using a Drosophila strain in which PINK1 gene expression was reduced in neurons. These flies also showed longer 

Fig. 4. PINK1 and white mutations reduce levels of other proteins involved in synaptic transmission in the Drosophila brain. (A‑D) Densitometric analysis of Syntaxin (A), Rab5 (B), Wishful Thinking (C) and Synaptotagmin (D) in Canton S, w1118 and PINK19 whole heads. Protein levels were standardized to Tubulin. Statistically significant differences are represented by three stars (p=0.01), two star (p<0.05) and one star (p=0.05). 
238 B. Doktór et al. Acta Neurobiol Exp 2018, 78: 231–241 
day sleep and a reduced total activity time in 24 h when compared with controls. This result suggests a role for PINK1 in maintaining sleep and activity phases. Interestingly, behavioral changes were observed only during the day when the number of mitochondria is normally higher than during the night. Since PINK1 mutation disrupts the functions of mitochondria and their fission and fusion processes, we hypothesize that changes in the sleep/activity pattern of flies during the day might be correlated with the impairment of mitochondria in the brain during the day. 
PINK1 mutation directly affects synapses by decreasing the level of the presynaptic protein BRP and other proteins (Rab5, Syntaxin and WIT) involved in synaptic 

Fig. 5 PINK1 mutation affects morphology of synaptic vesicles. (A‑B) TEM micrographs of tetrad synapses of Canton S (A), w1118 (B) and PINK19 (C). Arrow 
– synaptic vesicles, PE – presynaptic element, PO – postsynaptic element, AZ – active zone. 
Acta Neurobiol Exp 2018, 78: 231–241 PINK1 mutation affects synapses and behavior 239 
transmission in the brain of Drosophila melanogaster. In addition to the brain, we examined BRP and synaptic vesicles in tetrad synapses in the visual system. In these types of synapses in the distal lamina BRP can predominantly be measured in tetrad synapses and it is known that the number of tetrad synapses and the BRP level in these synapses oscillate during the day and night with the same pattern (Górska‑Andrzejak et al. 2013, Mein
ertzhagen and Pyza 1999, Woźnicka et al. 2015). The 
number of tetrad synapses peaks twice, in the morning and in the evening and is also higher after light exposure (Pyza and Meinertzhagen 1993). Both peaks during the day are correlated with a high level of BRP, swelling of postsynaptic interneurons of tetrad synapses (Pyza and Meinertzhagen 1999) and peaks of locomotor activity rhythm in Drosophila (Górska‑Andrzejak et al. 2013). We found that the PINK1 mutation reduces BRP level in tetrad synapses, however, the circadian rhythm in the BRP level is maintained. The fact that daily expression of BRP in the lamina of PINK1 mutants was not affected is surprising since an involvement of mitochondria in neuroplasticity and synaptic plasticity in the brain is well documented. However, this observation and behavioral data suggests that circadian plasticity in the visual system is less dependent on the activity of mitochondria than in other parts of the brain. 
Since a similar result was found in the case of BRP in whole brain homogenates, the impairment of synapses occurs in all synapses in the brain and probably in neuromuscular junctions where BRP is also a presynaptic protein (Wagh et al. 2006). 
Because of low transmission levels in mutants, postsynaptic cells and muscles can degenerate. PINK1 mutants and flies with PINK1 RNAi had a lower level of BRP in the brain when compared with Canton S, w1118 and Valium10 controls. This indicates that PINK1 mutation affects synaptic contacts in the nervous system because of increasing the production of reactive oxygen species (ROS) (Chien et al. 2013). It has already been shown that the reduced level of BRP in brp mutants causes similar motor disorders to that observed in our study (Wagh et al. 2006). However, PINK1 mutation also causes degeneration of dopaminergic neurons (Yang et al. 2006), and perhaps may also affect other types of neurons that regulate motor activity. 
Furthermore, we showed that genetic background, white mutation, may also cause a reduction of BRP but this effect was seen only in tetrad synapses in the photoreceptor terminals and not in whole head homogenates. This result is correlated with an import‑ant function of WHITE in the eye. In Drosophila white mutants atypical pigment granules were found in the eye (Schraermeyer and Dohms 1993) and degeneration of the retina (Ambegaokar and Jackson 2010). The ABC transporter encoded by the white gene transports, in addition to pigment in photoreceptors, ions, amino acids, peptides and sugars across membranes (Savary et al. 1996) and white mutants show various abnormalities including a low level of neurotransmitters (Borycz et al. 2008). The level of the other proteins studied, except Rab5, was not significantly changed in white mutants. 

Fig. 6. The number of mitochondria in the lamina L2 interneurons oscillates during the day. (A) Localization of mitochondria labeled with GFP in L2 interneurons of the lamina of 21D‑GAL4>UAS‑mitoGFP. Re – retina, Ln – lamina neuropil, Arrow – cell bodies of L2 neurons, Frame – measurement area, Scale bar – 20µm. (B) The fluorescence index of GFP‑labeled mitochondria in the lamina neuropil measured in different time points of the day of 21D‑GAL4>UAS‑mtoGFP. Statistically significant differences (one star represents p=0.05) are between ZT1 and ZT13, ZT16; ZT4 and ZT13, ZT16. 
240 B. Doktór et al. 
CONCLUSIONS 

In the present study we proved that PINK1 is required for maintaining sleep during the day and synaptic transmission by the regulation of synaptic protein levels. The lack of PINK1 results in the reduction of synaptic proteins responsible for exocytosis of neurotransmitters, which in turn may cause previously described motor and sleep disorders. We also showed that using white background, to create transgenic strains, leads to motor and non‑motor disorders in those flies. We suggest using w1118 as an additional control for strains with white background, because the comparison between Canton S and w1118 may give information on the effects of white mutation itself on the examined processes. 
ACKNOWLEDGEMENTS 

This study was supported by the Jagiellonian University grant K/ZDS/008070. In this study we used a Zeiss LSM 510 confocal microscope in the Laboratory of Microscopy, Department of Cell Biology and Imaging, Institute of Zoology and Biomedical Sciences, Jagiellonian University. 
REFERENCES 

Aberle H, Haghighi PA, Fetter RD, McCabe BD, Magalhães TR, Goodman CS (2002) Wishful thinking encodes a BMP Type II receptor that regulates synaptic growth in Drosophila. Neuron 33: 545–558. 
Ambegaokar SS and Jackson GR (2010) Interaction between eye pigment 
genes and tau‑induced neurodegeneration in Drosophila melanogaster. 
Genetics 186: 435–442. 
Borycz J, Borycz JA, Kubów A, Lloyd V, Meinertzhagen IA (2008) Drosophila ABC transporter mutants white, brown and scarlet altered contents and distribution of biogenic amines in the brain. J Exp Biol 211: 3454–3466. 
Chen Y and Dorn GW (2013) PINK1‑phosphorylated mitofusin 2 is a Parkin receptor for culling damaged mitochondria. Science 340: 471–475. 
Chien WL, Lee TR, Hung SY, Kang KH, Wu RM, Lee MJ, Fu WM (2013) Increase of oxidative stress by a novel PINK1 mutation, P209A. Free Radic Biol Med 58: 160–169. 
Clark IE, Dodson MW, Jiang C, Cao JH, Huh JR, Seol JH, Yoo SJ, Hay BA, Guo M (2006) Drosophila pink1 is required for mitochondrial function and interacts genetically with parkin. Nature 441: 1162–1166. 
Dawson TM and Dawson VL (2003) Molecular pathways of neurodegeneration in Parkinson’s disease. Science 302: 819–822. 
Deas E, Plun‑Favreau H, Gandhi S, Desmond H, Kjaer S, Loh SH, Renton AE, Harvey RJ, Whitworth AJ, Martins LM, Abramov AY, Wood NW (2011) PINK1 cleavage at position A103 by the mitochondrial protease PARL. Hum Mol Genet 20: 867–879. 
DiAntonio A, Haghighi AP, Portman SL, Lee JD, Amaranto AM, Goodman CS (2001) Ubiquitination‑dependent mechanisms regulate synaptic growth and function. Nature 412: 449–452. 
Eiyama A and Okamoto K (2015) PINK1/Parkin‑mediated mitophagy in mammalian cells. Curr Opin Cell Biol 33: 95–101. Ewart GD, Cannell D, Cox GB, Howells AJ (1994) Mutational analysis of the traffic ATPase (ABC) transporters involved in uptake of eye pigment pre‑
Acta Neurobiol Exp 2018, 78: 231–241 

cursors in Drosophila melanogaster. Implications for structure‑function relationships. J Biol Chem 269: 10370–10377. 
Feany MB and Bender WW (2000) A Drosphila model of Parkinson’s dis
ease. Nature 404: 394–398. 
Geppert M, Goda Y, Hammer RE, Li C, Rosahl TW, Stevens CF, Südhof TC (1994) Synaptotagmin I: a major Ca2+ sensor for transmitter release at a central synapse. Cell 79: 717–727. 
Górska‑Andrzejak J, Makuch R, Stefan J, Görlich A, Semik D, Pyza E (2013) Circadian expression of the presynaptic active zone protein Bruchpilot in the lamina of Drosophila melanogaster. Dev Neurobiol 
73: 14–26. 
Greene AW, Grenier K, Aguileta MA, Muise S, Farazifard R, Haque ME, McBride HM, Park DS, Fon EA (2012) Mitochondrial processing peptidase regulates PINK1 processing, import and Parkin recruitment. EMBO Rep 13: 378–385. 
Hoop MJ, Huber LA, Stenmark H, Williamson E, Zerial M, Parton RG, Dotti CG (1994) The involvement of the small GTP‑binding protein Rab5a in neuronal endocytosis. Neuron 13: 11–22. 
Kittel RJ, Wichmann C, Rasse TM, Fouquet W, Schmidt M, Schmid A, Wagh DA, Pawlu C, Kellner RR, illig KI, Hell SW, Buchner E, Heckmann M, Sigrist SJ (2006) Bruchpilot promotes active zone assembly, Ca2+ channel clustering, and vesicle release. Science 312: 1051–1054. 
Krstic D, Boll W, Noll M (2013) Influence of the white locus on the courtship behavior of Drosophila males. PLoS One 8: e77904. 
Lazarou M, Jin SM, Kane LA, Youle RJ (2012) Role of PINK1 binding to the TOM complex and alternate intracellular membranes in recruitment and activation of the E3 ligase Parkin. Dev Cell 22: 320–333. 
Liu W, Acín‑Peréz R, Geghman KD, Manfredi G, Lu B, Li C (2011) Pink1 regulates the oxidative phosphorylation machinery via mitochondrial fission. Proc Natl Acad Sci 108: 12920–12924. 
Li Z, Peng Y, Hufnagel RB, Hu YC, Zhao C, Queme LF, Khuchua Z, Driver AM, Dong F, Lu QR, Lindquist DM, Jankowski MP, Stottmann RW, Kao WWY, Huang T (2017) Loss of SLC25A46 causes neurodegeneration by affecting mitochondrial dynamics and energy production in mice. Hum Mol Genet 26: 3776–3791. 
Lu B and Vogel H (2009) Drosophila models of neurodegenerative diseases. Annu Rev Pathol 4: 315–342. 
Ly CV and Verstreken P (2006) Mitochondria at the synapse. Neuroscientist 
12: 291–299. 
Matsuda N, Sato S, Shiba K, Okatsu K, Saisho K, Gautier CA, Sou YS, Saiki S, Kawajiri S, Sato F, Kimura M, Komatsu M, Hattori N, Tanaka K (2010) PINK1 stabilized by mitochondrial depolarization recruits Parkin to damaged mitochondria and activates latent Parkin for mitophagy. J Cell Biol 189: 211–221. 
Meinertzhagen IA, O’Neil SD (1991) Synaptic organization of columnar elements in the lamina of the wild type in Drosophila melanogaster. J Comp Neurol 305: 232–263. 
Morais VA, Verstreken P, Roethig A, Smet J, Snellinx A, Vanbrabant M, Haddad D, Frezza C, Mandemakers W, Vogt‑Weisenhorn D, Van Coster R, Wurst W, Scorrano L, De Strooper B (2009) Parkinson’s disease mutations in PINK1 result in decreased Complex I activity and deficient synaptic function. EMBO Mol Med 1: 99–111. 
Ni JQ, Liu LP, Binari R, Hardy R, Shim HS, Cavallaro A, Booker M, Pfeiffer BD, Markstein M, Wang H, Villalta C, Laverty TR, Perkins LA, Perrimon N (2009) Drosophila resource of transgenic RNAi lines for neurogenetics. Genetics 182: 1089–1100. 
Park J, Lee SB, Lee S, Kim Y, Song S, Ki S, Bae E, Kim J, Shong M, Kim JM, Chung J (2006) Mitochondrial dysfunction in Drosophila PINK1 mutants is complemented by parkin. Nature 441: 1157–1161. 
Pilling AD, Horiuchi D, Lively CM, Saxton WM (2006) Kinesin‑1 and Dynein 
are the primary motors for fast transport of mitochondria in Drosophila 
motor axons. Mol Biol Cell 17: 2057–2068. 
Poole AC, Thomas RE, Andrews LA, McBride HM, Whitworth AJ, Pallanck LJ (2008) The PINK1/Parkin pathway regulates mitochondrial morphology. Proc Natl Acad Sci 105: 1638–1643. 
Acta Neurobiol Exp 2018, 78: 231–241 
Pyza E and Meinertzhagen A (1993) Daily and circadian rhythms of synaptic frequency in the first visual neuropile of the housefly’s (Musca domestica L.) optic lobe. Proc Biol Sci 254: 97–105. 
Pyza E and Meinertzhagen IA (1999) Daily rhythmic changes of cell size and shape in the first optic neuropil in Drosophila melanogaster. J Neurobiol 
40: 77–88. Rosato E and Kyracou CP (2006) Analysis of locomotor activity rhythms in Drosophila. Nat Protoc 1: 559–568. 
Savary S, Denizot F, Luciani M, Mattei M, Chimini G (1996) Molecular cloning of a mammalian ABC transporter homologous to Drosophila white gene. Mamm Genome 7: 673–676. 
Schraermeyer U and Dhms M (1993) Atypical granules in the eyes of the 
white mutant of Drosophila melanogaster are lysosome‑related organ
elles. Pigment Cell Res 6: 73–84. 
Shields M, Bowers MR, Fulcer MM, Bollig MK, Rock PJ, Sutton BR, Vrailas‑Mortimer AD, ller HL, Whittaker RG, Horvath R, Reist NE (2017) Drosophila studies support a role for a presynaptic synaptotagmin mutation in a human congenital myasthenic syndrome. PLoS One 12: e0184817. 
Sieber JJ, Willig KI, Heintzmann R, Hell SW, Lang T (2006) The SNARE motif 
is essential for the formation of syntaxin clusters in the plasma mem‑
brane. Biophys J 90: 2843–2851. 
Stenmark H (2009) Rab GTPases as coordinators of vesicle traffic. Nat Rev Mol Cell Biol. 10: 513–525. 
Thomas RE, Andrews LA, Burman JL, Lin WY, Pallanck LJ (2014) PINK1‑Parkin pathway activity is regulated by degradation of PINK1 in the mitochondrial matrix. PLoS Genet 10: e1004279. 
Ullrich A, Böhme MA, Schöneberg J, Depner H, Sigrist SJ, Noé F (2015) Dynamical organization of Syntaxin‑1A at the presynaptic active zone. PLoS Comput Biol 11: 1–22. 
PINK1 mutation affects synapses and behavior 241 

Wagh DA, Rasse TM, Asan E, Hofbauer A, Schwenkert I, Dürrbeck H, Buchner S, Dabauvalle MC, Schmidt M, Qin G, Wichmann C, Kittel R, Sigrist SJ, Buchner E (2006) Bruchpilot, a protein with homology to ELKS/ CAST, is required for structural integrity and function of synaptic active zones in Drosophila. Neuron 49: 833–844. 
Wang D, Qian L, Xiong H, Liu J, Neckameyer WS, Oldham S, Xia K, Wang J, Bodmer R, Zhang Z (2006) Antioxidants protect PINK1‑dependent dopaminergic neurons in Drosophila. Proc Natl Acad Sci 
103: 13520–13525. 
Weber P, Kula‑Eversole E, Pyza E (2009) Circadian control of dendrite morphology in the visual system of Drosophila melanogaster. PLoS One 4: e4290. 
Woźnicka O, Görlich A, Sigrist S, Pyza E (2015) BRP‑170 and BRP190 isoforms of Bruchpilot protein differentially contribute to the frequency of synapses and synaptic circadian plasticity in the visual system of Drosophila. Front Cell Neurosci 9: 1–8. 
Wucherpfennig Tanja, Wilsch‑Bräuninger Michaela, González‑Gaitán Marcos (2003) Role of Drosophila Rab5 during endosomal trafficking at the synapse and evoked neurotransmitter release. J Cell Biol. 161: 609–624. 
Yamano K and Youle RJ (2013) PINK1 is degraded through the N‑en rule pathway. Autophagy 9: 1758–1769. 
Yang Y, Gehrke S, Imai Y, Huang Z, Ouyang Y, Wang JW, Yang L, Beal MF, Vogel H, Lu B (2006) Mitochondrial pathology and muscle and dopaminergic neuron degeneration caused by inactivation of Drosophila Pink1 is rescued by Parkin. Proc Natl Acad Sci 103: 10793–10798. 
Ziviani E, Tao RN, Whitworth AJ (2010) Drosophila parkin requires PINK1 for mitochondrial translocation and ubiquitinates mitofusin. Proc Natl Acad Sci 107: 5018–5023.