New multilocus phylogeny reorganises the family Macrobiotidae (Eutardigrada) and unveils complex morphological evolution of the Macrobiotus hufelandi group Daniel Steca,*, Matteo Vecchib, Sara Calhimb, £ukasz Michalczyka,* aInstitute of Zoology and Biomedical Research, Jagiellonian University, Gronostajowa 9, 30-387 Krak´ow, Poland bDepartment of Biological and Environmental Science, University of Jyvaskyla, PO Box 35, FI-40014 Jyvaskyla, Finland   ARTICLE INFO  Keywords: Integrative taxonomy Molecular phylogeny Morphological evolution Sisubiotus gen. nov. Xerobiotus Tardigrada ABSTRACT  The family Macrobiotidae is one of the most speciose and diverse groups among tardigrades. Although there have been attempts to reconstruct the phylogeny of this family, the evolutionary relationships within Macrobiotidae are only superficially determined as available genetic data cover only a small fraction of this vast group. Here, we present the first extensive molecular phylogeny of the family based on four molecular markers (18S rRNA, 28Sr RNA, ITS-2 and COI) associated with detailed morphological data for the majority of taxa. The phylogenetic analysis includes nearly two hundred sequences representing more than sixty species, including sixteen taxa that have never been sequenced and/or analysed phylogenetically before. Our results recovered a new monophyletic group, comprising Macrobiotus spectabilis Thulin, 1928 and Macrobiotus grandis Richters, 1911, for which we erect a new genus, Sisubiotus gen. nov., to accommodate its evolutionary distinctiveness. The largest, so far, dataset for the family Macrobiotidae showed that the genus Xerobiotus is nested within the clade representing the genus Macrobiotus deeper than it was earlier assumed, therefore we propose to suppress Xerobiotus and transfer its species to Macrobiotus. Moreover, mapping key morphological traits onto macrobiotid phylogeny exposed complex evolution of phenotypes within the Macrobiotus hufelandi group, i.e. Macrobiotus s.s. Finally, our findings enabled a detailed revision and discussion on species compositions of the most ubiquitous tardigrade genera, species groups and species complexes, which resulted in changes of taxonomic statuses of a number of macro­biotid species. All this contributes to the reconstruction of the morphological evolution within Macrobiotidae.   1.Introduction Tardigrades, are a phylum of microscopic, segmented and eight- legged invertebrates, closely related to arthropods and onychophorans which together form the super clade Panarthropoda (Campbell et al., 2011). They are found in various environments, from ocean depths to mountain peaks and from polar caps to tropical forests throughout the globe (Nelson et al., 2015). To date, the phylum comprises over 1300 species representing 142 genera and 30 families (Guidetti and Bertolani, 2005; Degma and Guidetti, 2007; Degma et al., 2009–2020). The family Macrobiotidae Thulin, 1928 is one of the most species rich in the phylum and it comprises eutardigrades characterised by the absence of cephalic papillae, the presence of a compact epicuticular layer without pillar-like structures, double Y-shaped claws on each leg arranged symmetrically with respect to the median plane of the leg (configuration reported as: 2112), the presence of the ventral lamina (a strengthening bar on the ventral side of the buccal tube), and by laying ornamented eggs freely to the environment (Bertolani et al., 1996; Guidetti et al., 2000; Pilato and Binda, 2010; Marley et al., 2011). The family currently consist of nearly 300 species grouped within 14 genera, with 6 of them being originally classified as informal species groups/ complexes within the super-diverse genus Macrobiotus Schultze, 1834 (Biserovus Guidetti and Pilato, 2003, Calcarobiotus Dastych, 1993, Famelobiotus Pilato et al., 2004, Insuetifurca Guidetti and Pilato, 2003, Macrobiotus, Mesobiotus Vecchi et al., 2016, Minibiotus Schuster, 1980, Minilentus Guidetti and Pilato, 2003, Paramacrobiotus Guidetti al., 2009, Pseudodiphascon Ramazzotti, 1965, Pseudohexapodibius Bertolani and Biserov, 1996, Schusterius Kaczmarek and Michalczyk, 2006, Tenuibiotus *Corresponding authors. E-mail addresses: daniel_stec@interia.eu (D. Stec), matteo.m.vecchi@jyu.fi, matteo.vecchi15@gmail.com (M. Vecchi), sara.calhim@jyu.fi (S. Calhim), LM@tardigrada.net (£. Michalczyk).  Contents lists available at ScienceDirect Molecular Phylogenetics and Evolution journal homepage: www.elsevier.com/locate/ympev https://doi.org/10.1016/j.ympev.2020.106987 Received 14 May 2020; Received in revised form 3 October 2020; Accepted 7 October 2020   Imprint logo
Journal logo
Pilato and Lisi, 2010, Xerobiotus Bertolani and Biserov, 1996). The great majority of these taxa have been established based on morphology, with a clear monophyly confirmed by morphological and genetic data only for Paramacrobiotus and Mesobiotus (Guidetti et al., 2009; Vecchi et al., 2016). Moreover, after being split into numerous genera, Macrobiotus is still the largest and the most diverse taxon within the family and it re­mains polyphyletic (Bertolani et al., 2014). So far, the most studied species group within this genus has been the Macrobiotus hufelandi group (e.g. Bertolani and Rebecchi, 1993; Cesari et al., 2009; Bertolani et al., 2011a,b; Guidetti et al., 2013; Kaczmarek and Michalczyk, 2017; Stec et al., 2017a, 2018a, 2018b, 2018c; Coughlan and Stec, 2019; Kayastha et al., 2020). With records from all continents, the group has a cosmo­politan distribution (Kaczmarek and Michalczyk, 2017). Thirty years ago Biserov (1990a,b) proposed the formation of two subgenera within Macrobiotus: Macrobiotus and Orthomacrobiotus. The first comprised all then recognised species of the hufelandi group whereas the second grouped all remaining taxa assigned at the time to the genus Macro­biotus. However, this distinction was not commonly accepted and soon after Bertolani and Rebecchi (1993) discarded the idea of the two sub­genera within Macrobiotus, questioning monophyly of the Macrobiotus hufelandi group. Notably, the position presented by the latter authors seemed to be actually more justified and real, especially in the light of recent studies which showed that the Macrobiotus hufelandi group is much more diverse than it was thought. Specifically, two distinct evolutionary lineages were found within this complex that were firstly thought to be congruent with divergent egg chorion morphology (Stec et al., 2018a), but subsequent discoveries falsified this hypothesis (Stec et al., 2018c; Coughlan and Stec, 2019). The first molecular phylogeny of the family Macrobiotidae was constructed with COI sequences of eight species (Guidetti et al., 2005). Subsequent phylogenies, which were devoted to the whole phylum Tardigrada or the class Eutardigrada, were constructed using conser­vative markers such as 18SrRNA and 28SrRNA or their combination (Sands et al., 2008; Marley et al., 2011; Guil and Giribet, 2012; Bertolani et al., 2014; Guil et al., 2019). However, these phylogenies suffer from an underrepresentation of the less frequent and not easy to find taxa whereas ordinary, i.e. common species of the Macrobiotus hufelandi group and of the genera Mesobiotus and Paramacrobiotus are over­represented. Moreover, many of the sequences used in these studies are not linked with morphological data and come from unidentified species what significantly limits evolutionary inference. Thus, taking into consideration the remarkable species diversity within Macrobiotidae, it seems that the current knowledge on the phylogenetic relationships within this taxon is biased and only superficially examined. Therefore, in this study we present an extensive multilocus phylog­eny of the family Macrobiotidae with 67 new sequences representing 16 taxa that have not been sequenced and/or have never been analysed phylogenetically. Moreover, we map key taxonomic traits onto the Table 1 Information on moss samples with the species/populations of the family Macrobiotidae sequenced in the present study.  Sample/population code Species Locality Coordinates and altitude Collector FI.066* Macrobiotus cf. pallarii Finland, Jyv¨askyl¨a, Grannitti 62.13'24.60''N 25.46'20.40''E 84 m asl Matteo Vecchi ME.007 Macrobiotus cf. pallarii Montenegro, Crkvine 42.47'57.54''N 19.27'18.47''E 1015 m asl Aleksandra Rysiewska PL.015 Macrobiotus cf. pallarii Poland, Malin´owka, Yew Reserve 49.42'09.00''N 21.55'53.00''E 382 m asl Piotr G¹siorek US.057 Macrobiotus cf. pallarii USA, Great Smoky Mountains National Park, Purchase Knob 35.35'7.84''N 83.4'26.47''W 1492 m asl Nate Gross & Mackenzie McClay AT.002 Macrobiotus polonicus Austria, Purbach 47.54'56'’N 16.41'42'’E 130 m asl Aneta Rumler SK.003 Macrobiotus polonicus Slovakia, Bratislava 48.8'54.70''N 17.7'2.39''E 145 m asl Peter Degma FI.068* Macrobiotus vladimiri Finland, Jyv¨askyl¨a, Viitaniemi 62.15'15.10''N 25.43'36.10''E 94 m asl Matteo Vecchi FI.067* Sisubiotus spectabilis Finland, Jyv¨askyl¨a, Survontie 62.13'45.80''N 25.44'39.50''E 95 m asl Matteo Vecchi NO.054 Sisubiotus spectabilis Norway, vicinity of lake Avsjoen and E8 route 62.10'33.24''N 9.27'5.22''E 943 m asl Daniel Stec & Witold Morek ES.086 Tenuibiotus cf. ciprianoi Spain, Arag´on, Alerre, vicinity of Huesca 42.9'51.30''N 0.28'10.98''W 529 m asl Piotr G¹siorek & Witold Morek KG.128 Tenuibiotus danilovi Kyrgyzstan, Kum Dobo 42.13'22.62''N 75.27'17.82''E 2034 m asl Bart³omiej Surmacz & Witold Morek KG.140 Tenuibiotus tenuiformis Kyrgyzstan, Toluk 41.55'8.70''N 73.37'49.44''E 1517 m asl Bart³omiej Surmacz & Witold Morek PL.360 Xerobiotus aff. pseudohufelandi sp. PL.360 Poland, B³êdowska Desert 50.20'41.40''N 19.32'39.40''E 325 m asl Daniel Stec & Krzysztof Miler ZA.373 Xerobiotus aff. pseudohufelandi sp. ZA.373 South Africa, Cape of Good Hope, Western Cape 34.13'24.24''S 18.27'58.80''E 18 m asl Bart³omiej Surmacz & Witold Morek  *Tardigrade Reproductive Evolution Group (University of Jyv¨askyl¨a) sample codes: FI.066 =S14, FI.067 =S23, FI.068 =S15. D. Stec et al.                                                                                                                                                                                                                                     phylogeny and in result we reorganise macrobiotid systematics. On one hand, we demonstrate a novel clade comprising two species, Macrobiotus spectabilis Thulin, 1928 and Macrobiotus grandis Richters, 1911, for which we erect a new genus, Sisubiotus gen. nov. On the other hand, we supress the genus Xerobiotus since it is nested deep within the Macro­biotus hufelandi group. Our integrative analysis also exposes new species complexes and unveils complex morphological evolution in the Macro­biotus hufelandi group. 2.Material and methods 2.1.Samples and specimens To reconstruct the phylogeny of the family Macrobiotidae, along with already published data, we analysed fourteen new populations representing eleven species isolated from moss samples collected from fourteen localities in different parts of the world (see Table 1 for details). In our study, by population we mean a group of conspecific individuals found in a single moss sample; furhermore, morphogroup is a non- monophyletic group of morphologically similar species; whereas spe­cies complexes are clades that cluster morphologically similar species. All samples were processed following a protocol described in detail in Stec et al. (2015). 2.2.Genotyping Genomic DNA was extracted from individual animals following a Chelex® 100 resin (BioRad) extraction method by Casquet et al. (2012) with modifications described in detail in Stec et al. (2020a). Each specimen was mounted in water on a temporary microscope slide and examined under light microscope prior to DNA extraction. We sequenced four DNA fragments, three nuclear (18S rRNA, 28S rRNA, ITS2) and one mitochondrial (COI) from 2 to 4 individuals per each of the 14 newly analysed populations. All fragments were amplified and sequenced according to the protocols described in Stec et al. (2020a); primers with their original references are listed in Table 2. Sequencing products were read with the ABI 3130xl sequencer at the Molecular Ecology Lab, Institute of Environmental Sciences of the Jagiellonian University, Krak´ow, Poland. Sequences were processed in BioEdit ver. 7.2.5 (Hall, 1999) and submitted to NCBI GenBank (Wheeler et al., 2006). 2.3.Phylogenetic analysis The phylogenetic analyses were conducted using concatenated 18SrRNA +28SrRNA +ITS-2 +COI macrobiotid sequences with the families Murrayidae and Richtersiidae as outgroups. To reconstruct the phylogeny, we used sequences representing six different genera of Macrobiotoidea (Supplementary Materials, SM.01). Sequences were downloaded from GenBank (SM.01). We choose sequences from taxa identified to species level, including also some approximated identifi­cations (“cf.”). Only taxa with sequences for at least the 18SrRNA or the 28SrRNA locus were included in the phylogenetic reconstruction, with a few exceptions (for which only COI sequences were available and were included in the analysis) as sequences from the type or neotype pop­ulations are available and we considered them important for the completeness of our analysis: Macrobiotus hufelandi C.A.S. Schultze, 1834, Macrobiotus macrocalix Bertolani and Rebecchi, 1993 and Mac­robiotus vladimiri Bertolani et al., 2011b. Finally, two very short 18S rRNA sequences classified as “Minibiotus intermedius” are present in GenBank (JX888505 and JX888504), however they were never officially published and they were not included in the analysis. Importantly, however, for the majority of taxa (more than 60%) the four markers were available, but none of the markers was present for all the taxa. The 18SrRNA, 28SrRNA and ITS-2 sequences were aligned using MAFFT ver. 7 (Katoh et al., 2002; Katoh and Toh, 2008) with the G-INS-i method (thread =4, threadtb =5, threadit =0, reorder, adjustdirection, anysymbol, maxiterate =1000, retree 1, globalpair input) for ITS-2 and G-INS-i method allowing for unaligned regions (thread =4, threadtb =5, threadit =0, reorder, adjustdirection, anysymbol, allow­shift, unalignlevel =0.1, maxiterate =1000, retree =1, globalpair input) for 18SrRNA and 28SrRNA. The COI sequences were aligned according to their aminoacid sequences (translated using the inverte­brate mitochondrial code) with the MUSCLE algorithm (Edgar, 2004) in MEGA7 (Kumar et al., 2016) with default settings (all gap penalties =0, max iterations =8, clustering method =UPGMB, lambda =24). Align­ments were visually inspected and trimmed in MEGA7. Aligned se­quences were concatenated with an in house R script wrote by MV. Model selection and phylogenetic reconstructions were done on the CIPRES Science Gateway (Miller et al., 2010). Model selection was performed for each alignment partition (8 in total: 18SrRNAa and b, 28SrRNAa and b, ITS-2 and three COI codons) with PartitionFinder2 (Lanfear et al., 2016), partitions and models selection process and re­sults are present in Supplementary Material (SM.02). 18S and 28S alignments were divided in two partitions due to the presence in both of them of two regions differing in their occupancy matrix. BI phylogenetic reconstruction was done with MrBayes v3.2.6 (Ronquist et al., 2012) without BEAGLE. Four runs with one cold chain and three heated chains were run for 50 million generations with a burning of 5 million gener­ations, sampling a tree every 1000 generations. Posterior distribution sanity was checked with the Tracer v1.7 (Rambaut et al., 2018) and with the R package RWTY (Warren et al., 2017). MrBayes input file with the input alignment is available as Supplementary Materials (SM.03). ML phylogenetic reconstruction was performed with RAxML-HPC Black Box 8.2.12 (Stamatakis, 2014) with 1000 bootstrap replicates and estimation of proportion of invariable sites (f =a, N =1000, m =GTRCATI).The Table 2 Primers with their original references used for amplification of the four DNA fragments sequenced in the study. Primer set LCO1490-JJ +HCO2198-JJ was used for COI amplification in six populations (FI.066, FI.067, NO.054, PL.015, PL.360, US.057); LCO1490 +HCO2198 was used in six populations (AT.002, ES.086, FI.068, KG.128, KG.140, SK.003); and LCO1490 +HCOoutout was used in two populations (ME.007, ZA.373). * – used only for S. spectabilis comb. nov. (FI.067).  DNA marker Primer name Primer direction Primer sequence (5'-3') Primer source 18S rRNA 18S_Tar_Ff1 forward AGGCGAAACCGCGAATGGCTC Stec et al. (2017b) 18S_Tar_Rr1 reverse GCCGCAGGCTCCACTCCTGG 28S rRNA 28S_Eutar_F forward ACCCGCTGAACTTAAGCATAT G¹siorek et al. (2018) 28SR0990 reverse CCTTGGTCCGTGTTTCAAGAC Mironov et al. (2012) 28S rRNA* 28Sa forward GACCCGTCTTGAAACACGGA Whiting et al. (1997) 28Srd5b reverse CCACAGCGCCAGTTCTGCTTAC Schwendinger and Giribet (2005) ITS-2 ITS2_Eutar_Ff forward CGTAACGTGAATTGCAGGAC Stec et al. (2018d) ITS2_Eutar_Rr reverse TCCTCCGCTTATTGATATGC COI LCO1490-JJ forward CHACWAAYCATAAAGATATYGG Astrin and Stüben (2008) HCO2198-JJ reverse AWACTTCVGGRTGVCCAAARAATCA  LCO1490 forward GGTCAACAAATCATAAAGATATTGG Folmer et al. (1994) HCO2198 reverse TAAACTTCAGGGTGACCAAAAAATCA HCOoutout reverse GTAAATATATGRTGDGCTC Prendini et al. (2005)  D. Stec et al.                                                                                                                                                                                                                                     Image of Fig. 1
(caption on next page) D. Stec et al.                                                                                                                                                                                                                                     phylogenetic trees were visualised with FigTree v1.4.4 (Rambaut, 2007) and the image was edited with Inkscape 0.92.3 (Bah, 2011). 2.4.Microscopy and imaging Specimens for light microscopy were mounted on microscope slides in a small drop of Hoyer’s medium and secured with a cover slip, following the protocol by Morek et al. (2016). Slides were examined under an Olympus BX53 light microscope with phase and Nomarski differential interference contrasts (PCM and NCM, respectively; named collectively as light contrast microscopy, LCM), associated with an Olympus DP74 digital camera. In order to obtain clean and extended specimens for SEM, tardigrades were processed according to the protocol by Stec et al. (2015). Specimens were examined under high vacuum in a Versa 3D DualBeam Scanning Electron Microscope (SEM) at the ATOMIN facility of the Jagiellonian University, Krak´ow, Poland. All figures were assembled in Corel Photo-Paint X6, ver. 16.4.1.1281. For structures that could not be satisfactorily focused in a single LCM photograph, a stack of 2–6 images were taken with an equidistance of ca. 0.2 µm and assembled manually into a single deep-focus image in Corel Photo-Paint. 2.5.Comparative material Animals and eggs from the neotype series of Mac. spectabilis and Mac. grandis from the Maucci collection (Civic Museum of Natural History of Fig. 2.Sisubiotus spectabilis comb. nov. from the Finnish population (FI.067) – habitus, body and leg cuticle morphology: A – adult specimen in dorso-ventral projection; B – granulation on the dorsal body cuticle visible in SEM; C – granulation on the external surface of leg II visible in LCM; D – internal surface of leg II with evident pulvinus visible in LCM; E – granulation on dorsal surface of leg IV visible in LCM; F – granulation on the external surface of leg II visible in SEM; G – internal surface of leg II with evident pulvinus visible in SEM; H – granulation on dorsal surface of leg IV visible in SEM. Arrows indicate fine body granulation visible only in SEM, filled flat arrowheads indicate granulation on the external surface of leg, empty flat arrowheads indicate a pulvinus-like cuticular bulge on the internal surface of leg, empty indented arrowheads indicate sparser and smaller part of granulation, filled indented arrowhead indicates denser and bigger part of granulation. Scale bar in µm. Fig. 1.Phylogenetic reconstruction of the family Macrobiotidae with key morphological traits mapped onto the species of the Macrobiotus hufelandi group (=Macrobiotus). Topology from BI reconstruction, nodes below 0.70 posterior probability length were collapsed. Support values are indicated as BI posterior probability/ML bootstrap. Black circle and no value =full support in both analyses, i.e. 1 for BI or 100 for ML; grey circle =node supported in both analyses but not fully in at least one of them (* =full support, BI/ML values lower than 1/100 shown); white circle and an en dash =node supported only in BI (– =node with BS <70% in the ML tree). Newly sequenced and/or newly analysed taxa/populations are bolded. Type, neotype and topotype sequences are underlined. Detailed legend for Macrobiotus hufelandi group morphotypes: claws: 1. hufelandi type (typical claws, as observed in Mac. hufelandi), 2. pseudohufelandi type (reduced claws with no lunules on legs I–III); chorion surface: 1. hufelandi type (reticulated), 2. maculatus type (porous), 3. persimilis type (solid), 4. pallari type (egg processes surrounded by one row of areolae), 5. nelsonae type (egg processes surrounded by two rows of areolae); egg process shape: 1. hufelandi type (mushroom-shaped), 2. paulinae type (mushroom-shaped with flexible filaments on terminal discs), 3. recens type (spike/filament-shaped), 4. pallarii type (conical with labyrinthine layer). D. Stec et al.                                                                                                                                                                                                                                     Image of Fig. 2
Verona, Italy) were analysed and photographed under LCM, what allowed for a more detailed comparison with their original descriptions/ redescriptions. 2.6.Morphometrics and nomenclature All measurements are given in micrometres (µm). Sample size was adjusted following recommendations by Stec et al. (2016). Structures were measured only if their orientation was suitable. Body length was measured from the anterior extremity to the end of the body, excluding the hind legs. The terminology used to describe oral cavity armature and egg shell morphology follows Michalczyk and Kaczmarek (2003) and Kaczmarek and Michalczyk (2017). Macroplacoid length sequence is given according to Kaczmarek et al. (2014). Buccal tube length and the level of the stylet support insertion point were measured according to Pilato (1981). The pt index is the ratio of the length of a given structure to the length of the buccal tube expressed as a percentage (Pilato, 1981). Measurements of buccal tube widths, heights of claws and eggs follow Kaczmarek and Michalczyk (2017). Morphometric data were handled using the “Parachela” ver. 1.7 template available from the Tardigrada Register (Michalczyk and Kaczmarek, 2013) and are given in Supple­mentary Materials (SM.04). Tardigrade taxonomy follows Bertolani et al. (2014) with updates from Guidetti et al. (2016) and Vecchi et al. (2016). 3.Results 3.1.Phylogeny of Macrobiotidae The BI and ML phylogenetic reconstructions yielded the same overall topology, but with lower bootstrap support values in the ML tree. Similarly to Bertolani et al. (2014), two major lineages within the family were recovered. In order to aid the description of phyletic relationships within the family Macrobiotidae, we term these lineages here as “superclade I” and “superclade II” (Fig. 1). Superclade I comprises three clades: a clade with genera Macrobiotus (polyphyletic) and Xerobiotus (monophyletic but nested within Macro­biotus, thus designated here as invalid; see Discussion, Section 4), and further two clades, one corresponding to the genus Mesobiotus (mono­phyletic) and the other containing Mac. grandis and Mac. spectabilis (monophyletic, designated here as Sisubiotus gen. nov.; see below for the diagnosis of the new genus, Section 3.2.3). More specifically, Mac­robiotus and Mesobiotus form a clade that is in a sister relationship with Sisubiotus gen. nov. Furthermore, the Macrobiotus +Xerobiotus clade is divided into three distinct evolutionary lineages (subclades A, B & C, respectively; Fig. 1). The first lineage (A) contains some species of the Macrobiotus hufelandi group as defined by Kaczmarek and Michalczyk (2017), including the type species for the genus (Mac. hufelandi s.s.), and species of the Macrobiotus nelsonae complex. Subclade B is morpholog­ically the most diverse and comprises species of the Macrobiotus persi­milis complex (falling under the broad definition of the Macrobiotus hufelandi group by Kaczmarek and Michalczyk (2017)), as well as spe­cies of the Macrobiotus pallarii complex, and species of the former genus Xerobiotus, now designated as the Macrobiotus pseudohufelandi complex. Finally, the lineage C comprises only some of the Macrobiotus hufelandi group species as defined by Kaczmarek and Michalczyk (2017). Superclade II consists of Minibiotus (paraphyletic and with the nested Macrobiotus furcatus Ehrenberg, 1859, which hereby is retransferred to Minibiotus), Tenuibiotus (monophyletic), and Paramacrobiotus (mono­phyletic). More precisely, Minibiotus gumersindoi is a sister species to all remaining taxa constituting superclade II, but this node is not strongly supported suggesting a possible polytomy, whereas all other analysed Minibiotus spp. (including Min. furcatus (Ehrenberg, 1859) stat. rev.; see Discussion for a detailed justification, Section 4) form a clade that is in a Fig. 3.Sisubiotus spectabilis comb. nov. from the Finnish population (FI.067) – claw morphology: A–B – claws I and IV seen in LCM; C–D – claws II and IV seen in SEM. Filled flat arrowheads indicate constriction in the claw common tract, empty flat arrowheads indicate double muscle attachments under claws, filled indented arrowheads indicate granulation on leg IV, the empty indented arrowhead indicates the faintly visible horseshoe-shaped structure. Scale bars in µm. D. Stec et al.                                                                                                                                                                                                                                     Image of Fig. 3
sister relationship to the clade formed by Tenuibiotus and Paramacrobiotus. To sum up, the following genera were found to be monophyletic: Mesobiotus, Sisubiotus gen. nov., Tenuibiotus and Paramacrobiotus. Min­ibiotus is paraphyletic with respect to the Tenuibiotus +Paramacrobiotus clade. Moreover, the most specious genus within the family, Macro­biotus, is polyphyletic with Macrobiotus echinogenitus (MH079513, MH079460) being akin to Adorybiotus granulatus as shown in Guil et al. (2019). Finally, GenBank sequences from the isolate Tar407 (FJ435741, FJ435756, FJ435807) represent an unidentified Paramacrobiotus species which was misidentified by Guil and Giribet (2012) as Macrobiotus pallarii Maucci, 1954. 3.2.Description of the new genus 3.2.1.Systematic and taxonomic account Phylum: Tardigrada Doy`ere, 1840 Class: Eutardigrada Richters, 1926 Order: Parachela Schuster et al., 1980 (restored by Morek et al., 2020) Superfamily: Macrobiotoidea Thulin, 1928 Family: Macrobiotidae Thulin, 1928 Genus: Sisubiotus gen. nov. Stec, Vecchi, Calhim and Michalczyk (Figs. 1–7) Fig. 4.Sisubiotus spectabilis comb. nov. from the Finnish population (FI.067) – buccal apparatus seen in LCM: A – an entire buccal apparatus; B–C – the oral cavity armature, dorsal and ventral teeth respectively; D–E – placoid morphology, dorsal and ventral placoids respectively. Filled flat arrowheads indicate the first band of teeth, empty flat arrowheads indicate the second band of teeth, filled indented arrowheads indicate the third band of teeth and empty indented arrowheads indicate central and subterminal constrictions in the first and second macroplacoid, respectively. Scale bars in µm. D. Stec et al.                                                                                                                                                                                                                                     Image of Fig. 4
3.2.2.Etymology The union of Sisu, a Finnish concept described as stoic determination, tenacity of purpose, grit, bravery, resilience, and hardiness that seems to fit well the resistance capabilities of tardigrades, and biotus, a common generic suffix in Macrobiotoidea. 3.2.3.Diagnosis Large and whitish Macrobiotidae with: (i) poreless cuticle, (ii) mouth opening surrounded by ten peribuccal lamellae, (iii) buccal apparatus of the Macrobiotus type, with a wide rigid buccal tube and a well-developed oral cavity armature (all three bands of teeth clearly visible in LCM, Fig. 6.Sisubiotus spectabilis comb. nov. from the Finnish population (FI.067) – eggs seen in LCM: A–B – midsections of two different eggs under ×400 magnification; C–D – surface under ×1000 magnification for the same eggs on two different focus levels; E–G – midsections of four different egg processes. Scale bars in µm. Fig. 5.Sisubiotus spectabilis comb. nov. from the Finnish population (FI.067) – the oral cavity armature seen in SEM: A–B – the oral cavity armature of a single specimen seen in SEM from different angles showing dorsal and ventral portion, respectively. Filled flat arrowheads indicate the first band of teeth, empty flat arrowheads indicate the second band of teeth, filled indented arrowheads indicate the third band of teeth. Scale bars in µm. D. Stec et al.                                                                                                                                                                                                                                     Image of Fig. 6
Image of Fig. 5
anterior teeth of the second band longitudinally elongated), (iv) two macroplacoids and a large microplacoid positioned close to them, (v) Y- shaped claws of the modified hufelandi type with lunules on each leg, (vi) ornamented eggs, laid freely, with areolation and conical processes without the labyrinthine layer that in many other macrobiotids is visible as reticulation in LCM. 3.2.4.Genus composition Sisubiotus spectabilis (Thulin, 1928) comb. nov. (type species) Sisubiotus grandis (Richters, 1911) comb. nov. Sisubiotus wuyishanensis (Zhang & Sun, 2014) comb. nov. (species inquirenda, please see the Discussion for details, Section 4.1.) Although S. grandis comb. nov. was described earlier than S. spectabilis comb. nov., the latter taxon is characterised in much more detail in this study, thus in order to secure the stability of taxonomy within the new genus, we designate S. spectabilis comb. nov. as the type species for Sisubiotus gen. nov. 3.2.5.Differential diagnosis Sisubiotus gen. nov., by the combination of morphological characters of animals and eggs is unique in the family Macrobiotidae, and it differs specifically from:  •Biserovus Guidetti and Pilato, 2003 by: the absence of the flexible pharyngeal tube, the number of macroplacoids in the pharynx (two in the new genus vs three in Biserovus) and the presence of lunules under claws (lunules absent in Biserovus).  •Calcarobiotus Dastych, 1993 by: the number of macroplacoids in the pharynx (two in the new genus vs three in Calcarobiotus) and a different claw type (the basal section of all claws without spurs, subdivided into a thin flexible stem and a distal section which is poorly sclerified and distally delimited by a septum, primary and secondary branches are rigidly joined to each other along a long common tract in Sisubiotus gen. nov. vs the basal section of each claw with or without basal spurs, subdivided into a thin flexible stem and Fig. 7.Sisubiotus spectabilis comb. nov. from the Finnish population (FI.067) – eggs seen in SEM: A – entire view of the egg; B–C – details of the egg surface between processes and areolation; D – egg process; E–F – top part of the processes covered with microgranulation. Filled flat arrowheads indicate the granulation on processes apices, filled indented arrowheads indicate microgranulation on the internal walls of areoles. Scale bars in µm. D. Stec et al.                                                                                                                                                                                                                                     Image of Fig. 7
a wide distal section in the shape of an upside-down triangle which is distally delimited by a septum, primary and secondary branches are similar in shape and size in Calcarobiotus).  •Famelobiotus Pilato et al., 2004 by: the number of macroplacoids in the pharynx (two in the new genus vs three in Famelobiotus) and the absence of the double third band of teeth in the oral cavity armature. •Insuetifurca Guidetti and Pilato, 2003 by: the number of macro­placoids in the pharynx (two in the new genus vs three in Insuetifurca) and the absence of the flexible pharyngeal tube.  •Macrobiotus Schultze, 1834 by: the absence of pores in the cuticle, the longitudinally elongated teeth in the anterior row of the second band of teeth of the oral cavity (when present, teeth only round in Mac­robiotus; except for Mac. andinus Maucci, 1988, which could repre­sent a separate lineage), and the lack of the labyrinthine layer in conical egg processes (when present, conical processes with clearly visible reticulation in LCM, at least in the lower part of the process, in Macrobiotus).  •Mesobiotus Vecchi et al., 2016 by: the number of macroplacoids in the pharynx (two in the new genus vs three in Mesobiotus) and the lack of the labyrinthine layer in conical egg processes (when present, conical processes with clearly visible reticulation in LCM in Mesobiotus).  •Minibiotus Schuster, 1980 by: the presence of peribuccal lamellae (peribuccal papulae in Minibiotus; but see also Stec et al. (2020a)), the number of macroplacoids in the pharynx (two in the new genus vs usually three in Minibiotus), adult body length (up to 900 µm in the new genus vs no more than 400 µm in Minibiotus). Remarks. Mini­biotus comprises divergent morphotypes, e.g. species with two and three macroplacoids in the pharynx, species with smooth and porous cuticle, and species in which these characters are intermixed. This strongly suggests that Minibiotus is polyphyletic (see the Discussion below).  •Minilentus Guidetti and Pilato, 2003 by: the number of macroplacoids in the pharynx (two in the new genus vs three in Minilentus), the presence of peribuccal lamellae (lamellae absent in Minilentus), and the absence of the flexible pharyngeal tube. •Paramacrobiotus Guidetti et al., 2009 by: the number of macro­placoids in the pharynx (two in the new genus vs three in Para­macrobiotus), the distance between the third macroplacoid and the microplacoid (the distance shorter than the microplacoid vs longer than the microplacoid in the P. richtersi complex or the microplacoid lacking in the P. areolatus morphogroup), and the lack of the laby­rinthine layer in egg processes (processes with clearly visible retic­ulation in Paramacrobiotus, excluding Paramacrobiotus csotiensis (Iharos, 1966a, 1966b)).  •Pseudohexapodibius Bertolani and Biserov, 1996 by: the claw morphology (Y-shaped claws of the hufelandi type with lunules in the new genus vs claws I–III strongly reduced, claws on legs IV rudi­mental or absent, lunules absent in Pseudohexapodibius).  •Schusterius Kaczmarek and Michalczyk, 2006 by: the number of macroplacoids in the pharynx (two in the new genus vs three in Schusterius) and the morphology of accessory points on the primary branches of claws (typical, short in the new genus vs extremely elongated and connected to primary branches by a flexible light- refracting portion in Schusterius).  •Tenuibiotus Pilato and Lisi, 2010 by: the claw morphology (primary and secondary branches joined over a shorter distance and the remaining free portion of the secondary branch forming an acute angle with the primary branch in the new genus vs primary and secondary branches joined over a long distance and the remaining free portion of the secondary branch is clearly shorter than the pri­mary branch, the branches form an almost right angle in Tenuibiotus). Remarks. Tenuibiotus most likely comprises more than one genus, as it contains species with two and three macroplacoids as well as species with and without pores in the cuticle (for more details please see the Discussion below, Section 4.1.). 4.Discussion 4.1.The phylogeny and systematics of Macrobiotidae The family Macrobiotidae is characterised by symmetrical claws and its monophyly has been consistently demonstrated by earlier phyloge­netic studies (Marley et al., 2011; Bertolani et al., 2014). However, the relationships between the macrobiotid genera and their composition are only partially resolved mainly because: (i) the available Macrobiotoidea phylogenetic trees are taxonomically biased, i.e. they largely comprise the most common species and lack many of the rare taxa, some of which may be crucial for the understanding macrobiotid evolution; (ii) even if sequences are available, they do not always represent homologous fragments of a given marker (this concerns especially the 18S and 28S rRNA); and (iii) for many species only a single marker is known, which results in missing data in the alignments, impeding the resolution of some phylogenetic relationships, especially with Maximum Likelihood phylogenetic methods that require relatively large amounts of data to obtain high bootstrap confidence values on short internodes (Alfaro et al., 2003). Specifically, there are no molecular data for eight out of the currently fifteen recognised macrobiotid genera: Biserovus, Calcar­obiotus, Famelobiotus, Insuetifurca, Minilentus, Pseudodiphascon, Pseudo­hexapodibius, and Schusterius. These genera are extremely rare and, except for Calcarobiotus and Insuetifurca, they are all monotypic. The remaining six genera, for which DNA sequences are available (Macro­biotus, Mesobiotus, Minibiotus, Paramacrobiotus, Tenuibiotus, and Xero­biotus), have been used in previous tardigrade phylogenetic studies (e.g. Guil and Giribet, 2012; Bertolani et al., 2014; Stec et al., 2018c; Guil et al., 2019). Notably, however, these phylogenies were based on one or two conservative ribosomal markers and on species for which DNA se­quences often were not associated with detailed morphological data, making their identifications uncertain (species identified to the genus/ complex level or with the confer “cf.” species status) and frequently also erroneous (please see Morek et al. 2019; Grobys et al. 2020; Stec et al. 2020b who found identification errors in some earlier studies). In contrast, our study provides, for the very first time, an extensive mul­tilocus phylogeny, based on four molecular markers for species with much better documented phenotypes than ever before. This allowed for more precise conclusions and led to the discovery of new evolutionary lineages and a new genus, but – at the same time – also led to grouping some other taxa within the family. Moreover, our results underline problems with species composition of some genera analysed in this study, which we discuss below (the order follows Fig. 1 from top to bottom). Macrobiotus, the first described tardigrade genus, is the most spe­ciose and diverse in the family even though many of its members have been stripped away to create new genera (see Introduction for details). The genus currently comprises 117 species, but only for ca. 6% of them have any DNA markers been sequenced. Moreover, the majority of Macrobiotus sequences (together with the suppressed Xerobiotus) form a monophyletic clade. Only Mac. furcatus and Mac. echinogenitus are not directly related with all the other analysed Macrobiotus species. Given that we have moved Mac. furcatus to the genus Minibiotus in this study, before discussing the Macrobiotus s.s. clade, only Mac. echinogenitus needs to be addressed. The DNA sequences of an individual from Greenland attributed to this species were produced by Guil et al. (2019) and their as well as our phylogenetic analyses point to Adorybiotus (Richtersiidae) as its closest kin. Three possible explanations for the results of Guil et al. (2019) can be given: (i) the sequences are from a legit Mac. echinogenitus individual and this species should be ascribed to Adorybiotus or (ii) to a new genus; (iii) this is a misidentified Macrobiotus crenulatus Richters, 1904, which has been moved to the recently erected genus Crenubiotus Lisi et al., 2020. The third possibility seems to be most likely given the long history of confusion between Mac. echinogenitus and Mac. crenulatus (Ramazzotti and Maucci, 1983; Binda, 1988). Never­theless, in all cases, an integrative redescription of Mac. echinogenitus D. Stec et al.                                                                                                                                                                                                                                     and/or Crenubiotus DNA sequences are needed to solve this problem. After suppressing the genus Xerobiotus and transferring its species to Macrobiotus, moving Macrobiotus furcatus back to Minibiotus, and assuming that GenBank sequences labelled as “Mac. echinogenitus” represent a species of the family Richtersiidae, all other Macrobiotus species analysed in our study form a monophyletic lineage, named here Macrobiotus s.s., which is further divided into three subclades A, B and C (Fig. 1). All species in this lineage conform to the definition of the Macrobiotus hufelandi group, proposed by Bertolani and Rebecchi (1993) and further refined by Guidetti et al. (2013), that encompasses species with animals exhibiting porous cuticle, up to three bands of teeth in the oral cavity, and two macroplacoids and a microplacoid in the muscle pharynx. Kaczmarek and Michalczyk (2017) attempted to narrow the definition to make it more practical taxonomically by adding three more criteria: (i) Y-shaped claws with lunules on all the legs, (ii) ornamented eggs with single-walled processes that are most often terminated with a distinct disc, (iii) and egg surface never covered with areolation. The first criterion was introduced to exclude Xerobiotus spp. and the two remaining criteria excluded species with conical and reticulated egg processes: Mac. pallari and Macrobiotus nelsonae Guidetti, 1998. At the time, the first of these two species was considered to be related to Par­amacrobiotus as it clustered with other species of that genus (Guil and Giribet, 2012; Bertolani et al., 2014; Guil et al., 2019). However, now, when more Paramacrobiotus and Mac. cf. pallari species have been sequenced, the single specimen identified by Guil and Giribet (2012) as “Mac. pallari” clusters with Paramacrobiotus spp., whereas the several correctly identified Mac. aff. pallari species are nested deeply within Macrobiotus s.s. (Fig. 1). Thus, now, when Mac. aff. pallari species have been sequenced, it became apparent that Guil and Giribet (2012) mis­identified their specimen and the flawed sequences were repeatedly used in later studies (i.e. Bertolani et al., 2014; Guil et al., 2019), what explicitly shows that not all GenBank sequences can be trusted and that misidentifications may have long-term detrimental effects and impede progress in taxonomy and systematics. The second species, Mac. nelso­nae, was considered a likely sample labelling error because egg morphology significantly departs from the classical Mac. hufelandi morphotype. Nevertheless, Kaczmarek and Michalczyk (2017) stated that their narrowed diagnosis of the Mac. hufelandi group should be considered as a “working definition” to aid species identification. However, our phylogenetic analysis, by demonstrating the presence of a Fig. 8.Comparative morphological figure of Xerobiotus sp. from Poland (PL.360, left column) and Macrobiotus cf. pallarii from Montenegro (ME.007, right column): A–B – buccal apparatus; C–D – cuticular pores; E–F – claws on leg III; G–H – egg surface under ×1000 magnification; I–J – egg midsection under ×1000 magni­fication. Filled flat arrowheads indicate terminal discs with indented margins on the egg processes. Scale bars in µm. D. Stec et al.                                                                                                                                                                                                                                     Image of Fig. 8
potential Mac. nelsonae complex in subclade A and the presence of the Mac. pallarii and Mac. pseudohufelandi complexes in subclade B, leaves no doubt that the definition by Kaczmarek and Michalczyk (2017) en­compasses a polyphyletic group of species. Thus, in the current dataset the genus Macrobiotus s.s. is equivalent to the Mac. hufelandi mor­phogroup as defined by Guidetti et al. (2013), with the inclusion of species of the supressed Xerobiotus. The three subclades within Macrobiotus s.s., exhibiting an [(A +B) +C] topology, are clearly delineated in our analysis (Fig. 1). However, with hindsight, they can also be identified in earlier studies, Bertolani et al. (2014) and Stec et al. (2018c), although with a different topology, [(A +C) +B], and a weaker support. In Bertolani et al. (2014), the subclades were not noticed whereas in Stec et al. (2018c) clade B was considered an artefact because it contained Macrobiotus and Xerobiotus species. Thus, the present study is the first to acknowledge the three lineages within Macrobiotus s.s. Noting this clear phylogenetic division of the Macrobiotus s.s. clade, we attempted to find morphological syn­apomorphies for the three subclades to investigate the possibility of designating them as separate taxonomic units such as subgenera or genera of their own. However, we identified no traits or their combi­nations that would be exclusive to each subclade. For example, reduced (pseudohufelandi type) claws are present only in some species of subclade B, eggs with a reticulated chorion (hufelandi type) occur in all subclades, eggs with smooth chorion (persimilis type) are present in subclades B and C, cone-shaped egg processes (pallari type) are found in subclades A and B, and single-walled mushroom-shaped egg processes (hufelandi type) occur in all subclades, etc. There are, however, four complexes that cluster closely related species exhibiting unique and uniform morphology. Even though these complexes do not align with the three subclades, delineating them may be taxonomically useful: the Macro­biotus nelsonae complex (characterised mainly by two rows of areolae between egg processes), Macrobiotus pallari complex (one row of areolae between egg processes), Macrobiotus persimilis complex (smooth egg chorion with mushroom-shaped processes, noted earlier by Bertolani et al. (2012; 2018) and Kaczmarek and Michalczyk (2009)), and Mac­robiotus pseudohufelandi complex (reduced claws); see Table 5 for more detailed diagnoses and species compositions of each complex. The Mac. nelsonae complex is nested within subclade A, whereas the remaining three complexes constitute the entire subclade B. For the time being, we propose to gather, for purely taxonomic purposes, all other Macrobiotus hufelandi group species listed by Kaczmarek and Michalczyk (2017) in a polyphyletic Macrobiotus hufelandi morphogroup as defined in Table 5. Nevertheless, it should be noted that there are other morphologically unique species or groups of species within the genus Macrobiotus, such as the Macrobiotus polyopus group (see Pilato 2006) or Macrobiotus arie­kammensis group (see Tumanov 2005), for which there are no molecular data and their phylogenetic position has not yet been determined. If they turn out to be monophyletic and not nested within the Macrobiotus s.s., they are likely to become genera in their own right, similarly to Para­macrobiotus, Mesobiotus or Sisubiotus gen. nov. However, if they form clades nested within Macrobiotus, they could be delineated as species complexes similarly to Mac. nelsonae, Mac. pallarii, Mac. persimilis, and Mac. pseudohufelandi complexes identified here (Table 6). Also, it may be also worth investigating whether such species complexes with similar morphology also exhibit similar ecological characteristics, such as diet, microhabitat type or geographic distribution. Xerobiotus was erected by Bertolani and Biserov (1996) using exclusively phenotypic characters. Specifically, the genus was estab­lished to accommodate two Macrobiotus species, Mac.pseudohufelandi Iharos, 1966 and Mac.xerophilus Dastych, 1978, that exhibit extremely reduced claws and lunules only on the hind legs (in all other Macrobiotus species, claws are not reduced and they all are equipped with lunules). Up to date, only three Xerobiotus species, all with a limited number of records, have been described. However, in the light of current standards in tardigrade taxonomy, their descriptions can be considered as vague due to the insufficient documentation of morphological details that are vital for the identification of phenotypically similar species. Moreover, only for a single species, X. pseudohufelandi, are DNA sequences avail­able (18S rRNA and COI from Guidetti et al., 2005; Bertolani et al., 2014), thus it was the only of the described species that could be used in our study. In earlier phylogenetic studies of the family Macrobiotidae (Bertolani et al., 2014; Stec et al., 2018c), X. pseudohufelandi clustered together with Mac.polonicus Pilato et al., 2003 in a clade that was sister to the remaining clades of the Macrobiotus hufelandi group, thus there was an expectation that with sequences for more species, Xerobiotus will become a clade that is sister to all species of the Mac. hufelandi group (Stec et al., 2018c). In the present study, we provided new molecular data by sequencing four molecular markers for further two yet unde­scribed Xerobiotus species, one from Europe (Poland) and the other from Africa (RSA) (Table 1). Instead of separating Xerobiotus from Macro­biotus, our analysis showed that all sequenced Xerobiotus species form a well-supported clade nested deeply within clade B (Fig. 1), rendering the hypothesis that Xerobiotus constitutes an independent phyletic line un­likely (hence the genus is supressed and its species are grouped in the Macrobiotus pseudohufelandi complex; see Table 5). In fact, apart from the claw morphology, Xerobiotus is morphologically indistinguishable from the Macrobiotus hufelandi group as both taxa share the same buccal apparatus and spermatozoon morphology (Dastych & Alberti 1990; Guidi and Rebecchi, 1996; Rebecchi et al., 2000, 2011; Guidetti et al., 2005; Bertolani et al., 2014). Although the presence of cuticular pores, one of the key traits defining the Mac. hufelandi group, has not been verified by SEM in all Mac. pseudohufelandi complex species, it seems very likely that they are present but their diameter is below the LCM resolution (see Kaczmarek and Michalczyk 2017 for a detailed discus­sion on this). Moreover, egg shell ornamentation with mushroom- shaped processes in Mac. pseudohufelandi (Iharos, 1966a, 1966b) stat. rev. and in the unidentified species from Poland, Mac. aff. pseudohufe­landi sp. PL.360 (Fig. 8), is typical for the majority of species of the hufelandi group (eggs are not known for Mac. euxinus (Pilato et al., 2011) comb. nov. and for the South African species analysed herein; Mac. xerophilus (Dastych, 1978) stat. rev. exhibits a unique type of egg ornamentation, but in recent years various new egg morphotypes were found in some species of the hufelandi group, e.g. in Mac. kristenseni Guidetti et al., 2013 or Mac. scoticus Stec et al., 2017a, thus a deviation from the typical process shape does not exclude a species from the Mac. hufelandi group; see Table 5 for examples). Thus, it seems that reduced claws in the Mac. pseudohufelandi complex are a relatively recent adaptation to dwelling in dense media such as soil that evolved in a single lineage within the Mac. hufelandi group that otherwise inhabits mostly much less dense mosses. Therefore, one way to preserve the genus would be to split the Mac. hufelandi group into three genera that correspond with clades A–C in Fig. 1. This, however, is not possible as currently there are no recognisable apomorphies that would allow for the erection of such genera (see above for details). Another solution to keep Xerobiotus, would be to erect new genera for the two other species complexes within subclade B identified in this paper, i.e. the Mac. pallari and the Mac. persimilis complex. However, under such scenario, the remaining species of the currently monophyletic genus Macrobiotus with a well-defined synapomorphy (porous cuticle combined with the buccal apparatus of the Mac. hufelandi type) would become polyphyletic with no foreseeable chances for the delineation of genera to accommodate species in subclades A and C (the same morphotypes are present within these subclades; see Fig. 1). Moreover, given that the majority of Mac­robiotus species have not yet been sequenced, the apomorphies may be broken if species representing divergent phenotypes are found to be nested within the currently recognised complexes or species exhibiting similar phenotypes cluster in different subclades. Therefore, taking into consideration the above, the most parsimonious solution is to supress the genus Xerobiotus and retransfer all its species to Macrobiotus with new combinations as members of the Macrobiotus pseudohufelandi complex (please see the Systematic account, Section 5.1. and Table 5 for details). D. Stec et al.                                                                                                                                                                                                                                     Mesobiotus was erected by an integrative analysis of two former species complexes in the genus Macrobiotus, the harmsworthi and the furciger groups. Vecchi et al. (2016) demonstrated that these groups are morphologically different from other macrobiotid genera and form a monophyletic clade. The monophyly of Mesobiotus was positively veri­fied by Guil et al. (2019) and the present study. Similarly to the genus Paramacrobiotus, species representing the two species groups within Mesobiotus are intermixed, thus currently no subgeneric ranks can be established to accommodate them (Kaczmarek et al. 2018). The new genus Sisubiotus, erected in this study, comprises currently only three species. Two of them, S. spectabilis comb. nov. and S. grandis comb. nov. have been considered for many years as species inquirenda (Dastych, 1973). However, the study by Maucci and Pilato (1974) showed that these two species are valid and they can be distinguished by the position of eyes (anterior in S. spectabilis comb. nov. vs posterior in S. grandis comb. nov.), the morphology of the second band of teeth in the oral cavity (additional rows of small teeth in S. spectabilis vs second band almost absent or composed by a few teeth in S. grandis comb. nov.), the size of macroplacoids (longer in S. spectabilis comb. nov.) and details of the egg shell (reticulated areola surface and smooth processes in S. spectabilis comb. nov. vs areola surface without reticulation and processes with small opaque areas in S. grandis comb. nov.). Although Dastych (1973) redescribed S. spectabilis comb. nov. based on a Polish population, the neotype for this species was established by Maucci and Pilato (1974) from Croatia, and the neotype for S. grandis comb. nov. – from Italy. Although those works presented new important data for both species, they do not conform to the current standards in tardigrade taxonomy. Therefore, here, we provide an integrative description for S. spectabilis comb. nov., presenting detailed morphological data asso­ciated with DNA sequences (see Section 5.2.). Nevertheless, the validity of S. grandis comb. nov. is also supported by our phylogenetic analysis as the sequences representing the species form a distinct lineage that is sister to the cluster of sequences representing S. spectabilis comb. nov. (Fig. 1). The third species in the new genus, Sisubiotus wuyishanensis comb. nov., was described from China. Even though the description is recent, the morphological characterisation is insufficient to differentiate the taxon from the remaining two Sisubiotus species. Specifically, the main character delineating S. wuyishanensis comb. nov. is supposed to be the lack of egg areolation, but the areolation is obvious in Fig. 6 in Zhang and Sun (2014). Other morphological/morphometric characters used in the differential diagnosis are minute and could be interpreted as intraspecific variability. Thus, we propose to consider S. wuyishanensis comb. nov. as species inquirenda. Soon after Schuster et al. (1980) erected the genus Minibiotus, its validity has been questioned by Pilato (1982) and later by Ramazzotti and Maucci (1983), who criticised it for an insufficiently clear diagnosis. Nevertheless, the genus survived the criticism and its status was strengthened by the revision of Claxton (1998) who attempted to make the genus diagnosis more precise. Currently, Minibiotus is no longer questioned, but the considerable morphological heterogeneity of this taxon which comprises species with and without cuticular pores, two or three macroplacoids, a single or two bends of the buccal tube, and egg processes free or enclosed in a membrane, strongly suggest that more than one genus is hiding under the name Minibiotus (Stec et al., 2020a). However, of the currently known 49 Minibiotus species, DNA sequences are available for only four named species, Minibiotus furcatus stat. rev., Minibiotus gumersindoi Guil and Guidetti, 2005, Minibiotus pentannulatus Londo~no et al., 2017, and Minibiotus ioculator Stec et al., 2020a, which form a paraphyletic group at the ‘base’ of superclade II. Although Min. ioculator, in contrast to the three remaining sequenced Minibiotus spe­cies, does not have cuticular pores, the four sequenced species do not cover the abovementioned morphological diversity and, in turn, do not yet allow for testing the phyletic nature of the genus and the relationship between morphology and phylogeny. The history of the systematic po­sition of Min. furcatus stat. rev. is a good illustration of problems associated with the diagnosis of the genus Minibiotus. The species, originally described as a Macrobiotus by Ehrenberg in 1859 (i.e. long before Minibiotus was erected), was transferred to the genus Minibiotus by Binda and Pilato (1992) based on LCM observations of its morphology. However, recently Bertolani et al. (2014) observed that Min. furcatus stat. rev. was related more closely to Paramacrobiotus than to other analysed Minibiotus spp. in their phylogenetic analysis of Mac­robiotidae; (ii) spermatozoa of Min. furcatus stat. rev. and Para­macrobiotus are morphologically similar; and (iii) SEM observations revealed that Min. furcatus stat. rev. has reduced peribuccal lamellae instead of papulae that are expected to characterise a Minibiotus species. At the same time, given that the overall morphology of Min. furcatus stat. rev. does not fit the diagnosis of Paramacrobiotus, Bertolani et al. (2014) moved the species tentatively back to the genus Macrobiotus, even though other Macrobiotus species clustered in remote branches of the phylogenetic tree. Finally, we retransferred Min. furcatus stat. rev. back to Minibiotus in the present study because: (i) it forms a clade with two Minibiotus species in our phylogenetic analysis (Fig. 1); (ii) as already noted by Binda and Pilato (1992), Min. furcatus stat. rev. is morphologically much more similar to Minibiotus species than to Mac­robiotus species; (iii) a recent study by Stec et al. (2020a), who investi­gated two Minibiotus species with SEM, showed explicitly that their peribuccal structures, similarly to Min. furcatus stat. rev., are not papule but shortened and thickened lamellae packed closely to each other, what questions the diagnostic value of this character in Minibiotus; and (iv) the similarity of male gametes of Min. furcatus stat. rev. and Para­macrobiotus cannot be used to exclude the species from Minibiotus in the absence of knowledge on spermatozoon morphology in other Minibiotus species. In addition to Min. furcatus stat. rev., we also propose to transfer two Macrobiotus species to Minibiotus based on their original descriptions and LCM analysis by Fontoura et al. (2009) and a further species, Macrobiotus spertii Ramazzotti, 1957 that has three short mac­roplacoids and a closely placed microplacoid in the pharynx and egg processes equipped with a velum (please see Systematic account for details, Section 5.1.). Tenuibiotus was established by Pilato and Lisi (2010) solely on a morphological analysis of several former Macrobiotus species that exhibit a characteristic claw morphology, where the primary and the secondary branch diverge at an almost right angle. Zawierucha et al. (2016), who attempted to integratively redescribe Tenuibiotus voronkovi (Tumanov, 2007), provided the first molecular data for the genus. These sequences were used recently by Stec et al. (2018c) and Guidetti et al. (2019) who showed a close relationship between this species and species of the genus Paramacrobiotus. In the present study, all Tenuibiotus se­quences cluster in a single clade which is in a sister relationship with the Paramacrobiotus clade. However, it should be noted that the five species analysed herein share the most common morphotype in the genus, i.e. poreless cuticle and two macroplacoids in the pharynx, whereas there are also Tenuibiotus species with porous cuticle (e.g. Tenuibiotus hyper­onyx (Maucci, 1983)) or three macroplacoids (e.g. Tenuibiotus willardi (Pilato, 1977)). Thus, taking into consideration that the presence of pores and the number of placoids have been shown to hold a phyloge­netic signal in Macrobiotidae, it is likely that Tenuibiotus is polyphyletic. The genus Paramacrobiotus was erected by Guidetti et al. (2009) based on a morphological distinction and molecular monophyly of two former species complexes within Macrobiotus, known as the richtersi and the areolatus group. The monophyly of the genus was later verified in other studies (Bertolani et al., 2014; Guidetti et al., 2019; Guil et al., 2019; this study). Recently, a division into two subgenera comprising species of the richtersi and areolatus groups have been proposed using a morphological criterion, i.e. the presence vs the absence of micro­placoid, respectively (Kaczmarek et al., 2017; Marley et al. 2018). However, soon after, the subgenera were questioned by Guidetti et al. (2019) who demonstrated the polyphyly of both taxa using 18SrRNA and 28SrRNA. Most recently, Stec et al. (2020b), by a phylogenetic analysis of four genetic markers, showed that the richtersi group is monophyletic, but the areolatus group is paraphyletic, which also D. Stec et al.                                                                                                                                                                                                                                     questioned the subgenera. The different phyletic relationships between and within the richtersi and areolatus groups found by Guidetti et al. (2019) and by Stec et al. (2020b) suggest that a greater taxon sampling and possibly new genetic markers are needed to solve Paramacrobiotus phylogeny. 4.2.Morphological evolution in Macrobiotidae The analysis of the obtained phylogenetic tree in conjunction with morphological data allowed us to discuss the evolution and taxonomic value of the key traits used in macrobiotid taxonomy: cuticle, claws, buccal apparatus, and eggs. The presence or absence of pores in the cuticle seems to bear a strong phylogenetic signal in the Macrobiotidae. Here, we analysed six genera and all, except Minibiotus, are mono­phyletic under the currently available species dataset (Fig. 1). Four of the five monophyletic genera are uniform regarding the cuticular pores and their monophyly is supported by good taxonomic sample size: Macrobiotus (with pores), and Mesobiotus, Paramacrobiotus and Sisubiotus gen. nov. (without pores). Interestingly, the phylogenetic status of the two genera which both comprise a mix of species with porous and poreless cuticle, Tenuibiotus and Minibiotus, is not certain. Specifically, the fact that all five species of Tenuibiotus analysed in our study have no pores in the cuticle and they form a monophyletic cluster, is in line with the pattern observed in Mesobiotus, Paramacrobiotus and Sisubiotus gen. nov. Thus, we should expect that Tenuibiotus representatives with porous cuticle will form a separate clade. However, the lack of DNA sequences for such species currently does not allow to test this hypothesis. As noted above, Mini­biotus is currently paraphyletic, but the poreless Min. ioculator clusters together with the porous Min. furcatus stat. rev. and Min. pentannulatus (Fig. 1), which could suggest that the presence of cuticular pores is a variable state within the genus. Moreover, when pores are present, they can vary between species by their size, shape and arrangement on the dorsal cuticle. However, given that phyletic relationships within Mini­biotus are not resolved, the question whether the presence and shape of pores bear a phylogenetic signal cannot be answered until more species with divergent morphotypes are sequenced (Stec et al. 2020a). Also claws seem to be phylogenetically important within this family as their morphology was used as a diagnostic criterion for the erection of Calcarobiotus, Mesobiotus, Schusterius, Tenuibiotus, and the suppressed Xerobiotus. However, until now, only for Mesobiotus and partially for Tenuibiotus has the monophyly been molecularly confirmed (Vecchi et al., 2016; this study). Nevertheless, the overall similarity of claws in Calcarobiotus, Insuetifurca, Mesobiotus and Schusterius, combined with the similarities of the anatomy of their buccal apparatuses (see also the paragraph below), suggest close phyletic relationships and it cannot be ruled out that some of these genera may by suppressed if molecular data show they are nested within other genera, as has been the case with Xerobiotus (Fig. 1). However, the example of Xerobiotus shows that claw morphology is not universally conservative and may be subject to intense evolutionary pressures in lineages that dwell in particular en­vironments, such as xeric and sandy habitats, where long claws may impede locomotion. Similar adaptations have been observed also in multiple genera representing two families in Isohypsibioidea: Dor­yphoribiidae (Apodibius Dastych, 1983 and some Doryphoribius Pilato, 1969a) and Hexapodibiidae (Haplohexapodibius Pilato and Beasley, 1987, Haplomacrobiotus May 1948, Hexapodibius Pilato, 1969b, and Parhexapodibius Pilato, 1969a) (Bertolani and Biserov, 1996; Hohberg et al., 2011; G¹siorek et al., 2019). The morphology of the bucco-pharyngeal apparatus has been used in tardigrade classification since the early works concerning the phylum (Ramazzotti and Maucci, 1983). Here, we confirmed that some char­acteristics of the buccal apparatus, such as the number, shape and arrangement of placoids, hold a strong phylogenetic signal since all clades corresponding to genera in our analysis (Fig. 1) are also defined by unique buccal apparatus variants. Assuming that the similarities in the morphology of the buccal apparatus may be used in phylogenetic inference, we hypothesise that the following genera with three macro­placoids and a large microplacoid may be closely related: Calcarobiotus, Famelobiotus, Insuetifurca, Mesobiotus and Schusterius, especially consid­ering the parallel similarities in claw morphology (see the paragraph above). On the other hand, similarly to cuticular pores, Tenuibiotus and Minibiotus are known to comprise species with different numbers of placoids in the pharynx. Furthermore, in Minibiotus we can find species with two bends (e.g. Min. ioculator, Min. pentannulatus) or only one bend of the buccal tube (e.g. Min. eichhorni Michalczyk and Kaczmarek, 2004). All this suggests the existence of multiple lineages within the two genera which may be revealed when more genetic data are available. Egg shell variation in tardigrades is known to bear phylogenetic and taxonomic significance (Bertolani et al., 1996), both in the presence or absence of ornamentation and oviposition type (uniform within genera), as well as in details of the chorion sculpture (characteristic at species level). Our results confirmed the hypothesis formulated in Guidetti et al. (2013) that chorion ornamentation evolves faster than animal morphology. The most widespread model of egg ornamentation in Macrobiotidae is chorion equipped with cone-shaped processes which is present in all macrobiotid genera in which the eggs are known (eggs are unknown for six of the fourteen described genera: Biserovus, Famelo­biotus, Insuetifurca, Minilentus, Pseudohexapodibius, and Schusterius). Furthermore, the cone-shape processes are present in all Richtersiidae and Murrayidae, excluding only Adorybiotus, which are sister to Mac­robiotidae and are used in our analysis as the outgroup. Thus, it is likely that the ancestor of Macrobiotidae laid eggs with cone-shaped processes. If this was indeed the case, then cone-shaped processes with branched or filamentous apices (in some species of Calcarobiotus, Minibiotus, Meso­biotus and Tenuibiotus) and mushroom-shaped processes (in many Mac­robiotus s.s. species) are derived morphotypes. Whereas the first type of egg processes probably evolved independently several times, mushroom-shaped processes are present only within Macrobiotus s.s. and are exhibited by the majority of its species (Fig. 1), thus they are likely to be a symplesiomorphic state for the genus. However, the presence of species groups within Macrobiotus s.s. which are characterised by areo­lated eggs with conical processes (Fig. 8) that resemble eggs of the distantly related Paramacrobiotus, is an explicit example of the evolu­tionary plasticity of the egg shell ornamentation in the genus Macro­biotus s.s. If mushroom-shaped processes are indeed the ancestral state for Macrobiotus s.s., then the reversal to Paramacrobiotus-like eggs in the Mac. pallari and Mac. nelsonae complexes is truly remarkable, especially given the convergent evolution of the labyrinthine layer within the process walls (walls without the layer in mushroom-shaped processes; Fig. 8). Whereas the labyrinthine layer in species of the Mac. nelsonae complex forms Paramacrobiotus-like reticulation, the morphology of the layer in the Mac. pallarii complex exhibits interesting variation. Specif­ically, from well-developed reticulation in Mac. pallarii, Mac. ragonesei Binda et al., 2001, and the Montenegrin Mac. cf. pallarii population (ME.007, Fig. 8) through an intermediate state with reticulation visible only in the bottom part of egg processes in the Polish and the Finnish Mac. cf. pallarii populations (FI.066 and PL.015), to scattered bubbles in the American Mac. cf. pallarii population (US.057) and Mac. caymanensis Meyer, 2011 (see also figures 17–18 in Meyer 2011). Another important aspect of egg ornamentation, in the context of macrobiotid evolution, is the morphology of chorion surface (between egg processes) which ex­hibits a considerable variation across the family and several general states can be distinguished: solid (“smooth”), porous, and reticulated chorion surface, but also surface covered by areolation or semi- areolation formed by finger-like expansions radiating from process bases. Although areolation is found in several distinct macrobiotid lin­eages, it is the only of the five chorion surface states listed above that characterises some genera (i.e. Paramacrobiotus and Sisubiotus gen. nov.), whereas in other genera more than one state is present. The most drastic example is the genus Mesobiotus, in which all mentioned mor­photypes are present (Kaczmarek et al. 2020). Similarly to egg D. Stec et al.                                                                                                                                                                                                                                     processes, this extreme diversity in chorion surface also exemplifies the dynamics of the morphological evolution in Macrobiotidae. Similar incongruencies between taxonomically important traits (i.e. useful in species delineation and identification) and phylogeny were recently found in two distantly related genera, Milnesium (order Apochela) and Bryodelphax (class Heterotardigrada), by Morek and Michalczyk (2020) and G¹siorek et al. (2020), respectively. This may suggest that such a mosaic pattern of morphological evolution is common in tardigrades. If this is indeed true, then more genera that were established with the sole use morphology, such as Xerobiotus, may turn out to be invalid. Although this study presents the largest and most detailed phyloge­netic analysis of the family Macrobiotidae to date, there is still a plethora of questions to be answered regarding the phyletic affinities, morpho­logical evolution and systematics of this super-diverse tardigrade group. We would like to think that we start to see the picture painted by nature, but considering that over 80% of the known macrobiotid species have not yet been sequenced, including many that represent unique mor­photypes, and given that many more species are awaiting to be discovered, the systematics of the family could be far from stable and may undergo significant changes in the future. 5.Systematic account 5.1.Macrobiotus taxonomy Phylum: Tardigrada Doy`ere, 1840 Class: Eutardigrada Richters, 1926 Order: Parachela Schuster et al., 1980 (restored by Morek et al., 2020) Superfamily: Macrobiotoidea Thulin, 1928 Family: Macrobiotidae Thulin, 1928 Genus: Macrobiotus C.A.S. Schultze, 1834 (emended diagnosis) Diagnosis: Macrobiotidae with: (i) porous cuticle, (ii) mouth opening surrounded by ten peribuccal lamellae, (iii) a rigid buccal tube strengthened with the ventral lamina lacking a ventral hook, (iv) two elongated macroplacoids and a microplacoid positioned close to them, (v) Y-shaped claws of the hufelandi type with lunulae on each leg or claws are reduced and devoid of lunulae (only in the Mac. pseudohufe­landi complex), (vi) eggs with an ornamented shell laid freely to the environment. Remarks:.All characters presented in the original description of the following four species of Macrobiotus meet the taxonomic criteria of the genus Minibiotus (see Discussion for more details) and are thus transferred to the latter genus: Minibiotus furcatus (Ehrenberg, 1859) stat. rev., Minibiotus pseudofurcatus (Pilato, 1972), comb. nov. and Minibiotus lazzaroi (Maucci, 1986) comb. nov., Minibiotus spertii (Ramazzotti, 1957) comb. nov. Based on the genetic and morphological evidence presented in this study, the three currently recognised species of Xerobiotus are trans­ferred to Macrobiotus s.s. (see Discussion for more details): Macrobiotus pseudohufelandi (Iharos, 1966a, 1966b) stat. rev., Macrobiotus xerophilus (Dastych, 1978) stat. rev. and Macrobiotus euxinus (Pilato et al., 2011) comb. nov. Because of highly insufficient descriptions preventing a confident identification (often the lack of information on the key traits that are currently used to differentiate the species, such as leg granulation and/ or lunule morphology, and/or oral cavity armature, and/or morpho­metric characters, and/or vague description of the egg ornamentation Table 3 Measurements [in µm] of selected morphological structures of individuals from the Finnish population of Sisubiotus spectabilis (Thulin, 1928) comb. nov. mounted in Hoyer’s medium (N–number of specimens/structures measured, RANGE refers to the smallest and the largest structure among all measured specimens; SD–standard deviation).  CHARACTER N RANGE MEAN SD   µm pt µm pt µm pt Body length 28 443 – 989 907 – 1276 720 1109 122 91 Buccal tube            Buccal tube length 28 40.8 – 77.5  –  64.7 – 8.1 – Stylet support insertion point 28 32.6 – 62.5 78.5 – 81.9 52.0 80.3 6.7 1.0 Buccal tube external width 28 7.0 – 15.9 17.0 – 22.1 12.4 19.0 2.2 1.5 Buccal tube internal width 28 5.0 – 12.7 12.3 – 17.6 9.6 14.7 1.9 1.5 Ventral lamina length 27 24.5 – 47.1 54.8 – 64.8 39.4 60.9 5.2 2.3 Placoid lengths            Macroplacoid 1 28 12.9 – 25.0 24.7 – 35.3 20.0 30.8 3.3 2.4 Macroplacoid 2 28 8.6 – 19.7 17.6 – 26.0 14.3 21.9 2.8 2.2 Microplacoid 28 4.2 – 8.9 8.6 – 12.6 6.6 10.2 1.2 1.1 Macroplacoid row 28 24.1 – 46.6 49.6 – 63.0 37.5 57.8 6.2 3.5 Placoid row 28 29.6 – 55.7 59.1 – 77.6 45.6 70.3 7.3 3.9 Claw 1 heights            External primary branch 26 11.1 – 20.9 22.0 – 29.2 17.0 26.0 2.5 1.9 External secondary branch 24 8.6 – 16.5 17.3 – 22.7 13.0 20.0 2.1 1.8 Internal primary branch 26 10.6 – 19.8 19.7 – 28.4 16.0 24.5 2.5 2.0 Internal secondary branch 25 8.2 – 15.6 15.4 – 22.0 12.4 19.1 2.0 1.8 Claw 2 heights            External primary branch 25 12.4 – 22.8 24.3 – 36.8 18.2 28.4 2.9 2.7 External secondary branch 24 9.2 – 18.0 18.3 – 29.2 14.1 21.9 2.4 2.4 Internal primary branch 24 10.2 – 20.0 22.0 – 30.3 16.2 25.3 2.5 1.7 Internal secondary branch 23 7.6 – 16.5 17.1 – 26.7 12.9 20.1 2.3 2.1 Claw 3 heights            External primary branch 25 12.2 – 22.9 21.7 – 31.7 18.2 28.0 2.7 2.2 External secondary branch 22 8.9 – 17.7 17.4 – 24.5 14.0 21.6 2.3 1.8 Internal primary branch 24 11.4 – 20.9 21.5 – 28.9 16.5 25.4 2.5 2.0 Internal secondary branch 21 8.7 – 16.9 17.3 – 23.4 12.9 19.9 2.2 1.8 Claw 4 heights            Anterior primary branch 25 13.4 – 26.6 27.3 – 36.8 21.1 32.5 3.5 2.7 Anterior secondary branch 24 9.1 – 19.0 19.6 – 26.3 15.2 23.3 2.4 1.8 Posterior primary branch 25 14.6 – 27.2 29.8 – 38.8 22.5 34.7 3.5 2.6 Posterior secondary branch 23 11.2 – 19.8 21.7 – 27.9 16.4 24.9 2.3 1.9  D. Stec et al.                                                                                                                                                                                                                                     morphology), the following species are considered as nomina inquirenda: Macrobiotus annae Richters, 1908 nom. inq., Macrobiotus ascensionis (Richters, 1908) nom. inq., Macrobiotus brevipes Mihel¡ci¡c, 1971/72 nom. inq., Macrobiotus carsicus Maucci, 1954 nom. inq., Macrobiotus evelinae de Barros, 1938 nom. inq., Macrobiotus gemmatus Barto¡s, 1963 nom. inq., Macrobiotus hibiscus de Barros, 1942 nom. inq., Macrobiotus insignis Barto¡s, 1963 nom. inq., Macrobiotus kolleri Mihel¡ci¡c, 1951 nom. inq., Macrobiotus komareki Barto¡s, 1939 nom. inq., Macrobiotus longipes Mihel¡ci¡c, 1971/72 nom. inq., Macrobiotus ovidii Barto¡s, 1937 nom. inq., Macrobiotus ovovillosus Baumann, 1960 nom. inq., Macrobiotus papillosus Iharos, 1963 nom. inq., Macrobiotus porteri Rahm, 1931 nom. inq., Macrobiotus potockii Wêglarska, 1968 nom. inq., Macrobiotus rollei Heinis, 1920 nom. inq., Macrobiotus striatus Mihel¡ci¡c, 1949 nom. inq., Macrobiotus terricola Mihel¡ci¡c, 1951 nom. inq., Macrobiotus tetrapla­coides Fontoura, 1981 nom. inq., Macrobiotus topali Iharos, 1969 nom. inq., Macrobiotus virgatus Murray, 1910 nom. inq. Due to highly insufficient descriptions that lack many key traits used currently in species differentiation (listed above) and because of the doubtful descriptions of eggs that are deposited in exuviae what is atypical for the genus and the family, the following species are not identifiable and are considered as nomina dubia: Macrobiotus artiphar­yngis Iharos, 1940 nom. dub., Macrobiotus norvegicus Mihel¡ci¡c, 1971/72 nom. dub., Macrobiotus rubens Murray, 1907 nom. dub. Because of highly insufficient descriptions that lack many key traits used currently in species differentiation (listed above) and because of the lack of eggs description, which are most often crucial for species identification in Macrobiotidae, the following species are not identifi­able and are considered as nomina dubia: Macrobiotus shennongensis Yang, 1999 nom. dub., Macrobiotus yunshanensis Yang, 2002 nom. dub. All characters of animals and eggs presented in the original description of Macrobiotus caelicola Kathman, 1990 meet the morpho­logical criteria of Diaforobiotus Guidetti et al., 2016 (Eutardigrada: Richtersiidae), thus it is transferred to the genus with the following combination: Diaforobiotus caelicola (Kathman, 1990) comb. nov. 5.2.Integrative description of new populations of Sisubiotus spectabilis (Thulin, 1928) comb. nov. (Tables 3–4, Figs. 2–7) 5.2.1.Material examined: 45 animals, and 38 eggs. Specimens mounted on microscope slides in Hoyer’s medium (36a +26e), fixed on SEM stubs (5a +10e), processed for DNA sequencing (2a +2e from the Finnish population and 2a from the Norwegian population). 5.2.2.Localities of two new populations examined in this study: 62.13'45.8''N, 25.44'39.5''E, 95 m asl: Finland, Jyv¨askyl¨a, Table 5 Species complexes (clades clustering morphologically similar species) and the Macrobiotus hufelandi morphogroup (a polyphyletic group of morphologically similar species) within the monophyletic Macrobiotus s.s.. Regardless of the phylogenetic status of the groups listed in the table, they are all useful taxonomically. Monophyly states: +=monophyly confirmed by a phylogenetic analysis based on the currently available data (i.e. new sequences may negate the monophyly), – =lack of monophyly confirmed by a phylogenetic analysis, (+) =species in a polytomy but within a single clade, thus monophyly possible when sequences for additional species strengthen the statistical support. Underlined are species for which genetic data are available and their affiliation (or lack thereof) to particular species complexes was phylogenetically confirmed in the present study. Remarks: Macrobiotus ariekammensis and Macrobiotus polyopus groups (mentioned in the Discussion Section 4.1.) are not included in the table as genetic data for them are unavailable, thus their phylogenetic character and affinities are not known.  Species complex/ morphogroup Description Species (alphabetically) Monophyly Macrobiotus nelsonae complex Species with white body, hufelandi type claws and with eggs with conical processes (with the labyrinthine layer visible as reticulation under LCM) separated by two rows of areolae. deceptor*, nelsonae,cf. nelsonae (in Bertolani et al. 2014) (+) Macrobiotus pallarii complex Species with white body, hufelandi type claws and with eggs with conical processes (with the labyrinthine layer visible as reticulation or bubbles under LCM) separated by one row of areolae. caymanensis, pallarii, cf. pallarii (ME.007**, in this study), cf. pallarii (US.057**, in this study), cf. pallarii (PL.015/FI.066**, in this study), ragonesei +Macrobiotus persimilis complex Species with white body, hufelandi type claws and with single- walled egg processes (without the labyrinthine layer =not reticulated) in the shape of truncated cones terminated with a well-developed disc and with solid chorion surface (wrinkled but never porous or reticulated). anemone, caelestis, dulciporus, engbergi, halophilus, hyperboreus, marlenae, patagonicus, persimilis, polonicus, trunovae, +Macrobiotus pseudohufelandi complex (former Xerobiotus) Species with white body, strongly reduced claws on all legs and with lunulae present only on the hind legs. pseudohufelandi stat. rev., xerophilus stat. rev., euxinus comb. nov., aff. pseudohufelandi PL.360 (in this study), aff. pseudohufelandi ZA.373 (in this study) +Macrobiotus hufelandi morphogroup All species that do not fall under any of the four species complexes listed above, i.e. species with white or yellowish body, hufelandi type claws and with single-walled egg processes (without the labyrinthine layer =not reticulated): (i) in the shape of truncated cones terminated with a disc, or (ii) in the shape of cones, sometimes elongated into flexible filaments or spatula, or (iii) in the shape of pegs; with egg surface mostly reticulated or porous, but when solid, the processes are of a modified shape (e.g. terminal discs with flexible filaments or elongated into filaments or a spatula). almadai, biserovi, canaricus, dariae, denticulus, diversus, glebkai, horningi, hufelandi, hannae, humilis, iharosi, joannae, julianae, kamilae, kazmierskii, kristenseni, lissostomus, macrocalix, maculatus, madegassus, martini, modestus, naskreckii, nebrodensis, noemiae, noongaris, papei, paulinae, personatus, polypiformis, punctillus, ramoli, rawsoni, recens, sandrae, sapiens, scoticus, serratus, semmelweisi, seychellensis, shonaicus, sottilei, terminalis, wandae, vladimiri –  *– Provisional assignment as cuticular pores have to be confirmed with SEM analysis. **– Species under description in a separate paper. Table 4 Measurements [in µm] of selected morphological structures of the eggs from the Finnish population of Sisubiotus spectabilis (Thulin, 1928) comb. nov. mounted in Hoyer’s medium (N–number of eggs/structures measured, RANGE refers to the smallest and the largest structure among all measured specimens; SD–standard deviation).  CHARACTER N RANGE MEAN SD Egg bare diameter 7 93.5 – 121.5 107.8 11.1 Egg full diameter 7 146.2 – 213.5 175.4 22.1 Process height 72 23.8 – 47.4 32.6 5.1 Process base width 72 14.7 – 29.8 23.0 3.4 Process base/height ratio 72 40% – 111% 73% 17% Inter-process distance 72 3.9 – 13.7 8.2 2.0 Number of processes on the egg circumference 7 10 – 12 11.3 0.8  D. Stec et al.                                                                                                                                                                                                                                     Survontie; moss on a rock between roadside and forest; coll. 07.03.2019 by Matteo Vecchi. 62.10'33.24''N, 9.27'5.22''E, 943 m asl: Norway, Vicinity of lake Avsjoen and E8 route; mixed moss and lichen sample on a rock in a shrubland; coll. 23.07.2017 by Daniel Stec and Witold Morek (only two animals have been found in this sample and they were used for molec­ular analysis). 5.2.3.Slide and SEM stubs depositories: 36 animals (slides: FI.067.*, where the asterisk can be substituted by any of the following numbers 05–08, 13–16, 18) and 26 eggs (slides: FI.067.*: 09–12, 17) as well as SEM stub: 18.11 are deposited at the Institute of Zoology and Biomedical Research, Jagiellonian University, Gronostajowa 9, 30–387, Krak´ow, Poland. 5.2.4.Animals (measurements and statistics in Table 4): In live animals, body almost transparent in smaller specimens and white in larger animals; after fixation in Hoyer’s medium body trans­parent (Fig. 2A). Eyes present in live animals and after fixation in Hoyer’s medium. Cuticle poreless but dorsal cuticle covered with fine granulation visible only in SEM (Fig. 2B). Patches of fine granulation on the external surface of legs I–III as well as dorsal and dorso lateral of legs IV clearly visible in LCM (Fig. 2C, F) and SEM (Fig. 2E, H). The granu­lation on legs IV is composed of larger granules (microgranule aggre­gations) near the claws, but the granulation decreases proximally in size and gradually becomes the fine granulation that covers the entire dorsal cuticle (Fig. 2H). Leg granulation is composed of microgranule aggre­gations (Fig. 2F, H). A pulvinus is present on the internal surface of legs I–III (Fig. 2D, G). Claws slender, of the hufelandi type. Primary branches with distinct accessory points, a long common tract, and with an evident stalk con­necting the claw to the lunula (Fig. 3A–D). The end of the common tract is constricted in all claws but this is clearly visible in SEM and only sometimes in LCM (Fig. 3A, C–D). All lunulae smooth (Fig. 3A–D). Paired muscle attachments on legs I–III often very visible both in LCM and SEM (Fig. 3A, C), whereas the horseshoe-shaped structure under claws IV poorly visible only in LCM (Fig. 3D) but not in SEM. Mouth antero-ventral. Bucco-pharyngeal apparatus of the Macro­biotus type (Fig. 4A), with the ventral lamina and ten small peribuccal lamellae. The oral cavity armature well developed and composed of three bands of teeth, always clearly visible under LCM (Fig. 4B–C). The first band of teeth is composed of numerous small teeth visible in LCM as granules (Fig. 4B–C) and as cones in SEM (Fig. 5A–B), arranged in several rows, situated anteriorly in the oral cavity, just behind the bases of the peribuccal lamellae. The second band of teeth is situated between the ring fold and the third band of teeth and comprises 3–4 rows of teeth visible in LCM as granules (Fig. 4B–C) and as cones in SEM (Fig. 5A–B), but larger than those in the first band. The most anterior row of teeth within the second band comprises larger and longitudinally elongated teeth than the subsequent posterior rows (Fig. 4B–C and 5A–B). The teeth of the third band are located within the posterior portion of the oral cavity, between the second band of teeth and the buccal tube opening (Fig. 4B–C and 5A–B). The third band of teeth is divided into the dorsal and the ventral portion. Under both LCM and SEM, the dorsal teeth are seen as three distinct transverse ridges whereas the ventral teeth appear as two separate lateral transverse ridges between which one big tooth is visible (Fig. 4B–C). In SEM, ventral teeth are blunt whereas the dorsal teeth have indented and sharp margins (Fig. 5A–B). Pharyngeal bulb spherical, with triangular apophyses, two rod-shaped macroplacoids and a large microplacoid positioned close to them (i.e. the distance between the second macroplacoid is shorter than the microplacoid length; Fig. 4D–E). The macroplacoid length sequence is 2 <1. The first macroplacoid is anteriorly narrowed and constricted in the middle whereas the second has a sub-terminal constriction (Fig. 4E–F). 5.2.5.Eggs (measurements and statistics in Table 5): Laid freely, white, spherical with large conical processes, areolated (Fig. 6A–B and 7A). The labyrinthine layer between the process walls absent, i.e. matrix between the external and internal wall homogenous (Fig. 6A–G). The upper part of process surface is covered, to a varying extent, by microgranulation visible only under SEM (Fig. 7D–F). Each process is surrounded by ten to fourteen deep, areolae. Usually two rows of areolae are present between the neighbouring processes, but some­times only a single row connects the processes (Fig. 6C–D, 7A–D). Areolae rims thin and high, covered with micropores (visible only in SEM; Fig. 7D). In SEM, areola surface is reticulated (Fig. 7A–D), but under LCM only the knots of the mesh are visible as dots (Fig. 6C–D). 5.2.6.Reproduction The examination of animals freshly mounted in Hoyer’s medium revealed the lack of testis or spermathecae filled with spermatozoa in all of the analysed specimens. 6.Conclusions Our study, by increasing species sample size in reconstructing phy­logeny in comparison with earlier works, sheds new light on the evo­lution of Macrobiotidae. One of the discovered lineages is elevated to the genus level, Sisubiotus gen. nov. We also confirmed the monophyly for five out of the six studied genera which are additionally discussed and revised in our work. Our results further indicate that special effort should be made towards increasing sample size for the genus Minibiotus but also for the remaining, rarely found macrobiotid genera. Increasing taxonomic sample size will most probably lead to the discovery of new distinct evolutionary lineages within the family Macrobiotidae. CRediT authorship contribution statement Daniel Stec: Conceptualisation, Methodology, Software, Data cura­tion, Writing - original draft, Visualisation, Investigation, Writing - re­view & editing, Funding acquisition, Formal analysis. Matteo Vecchi: Methodology, Software, Data curation, Writing - original draft, Visual­isation, Formal analysis. Sara Calhim: Writing - original draft, Super­vision. £ukasz Michalczyk: Conceptualisation, Writing - original draft, Visualisation, Writing - review & editing, Funding acquisition, Supervision. Acknowledgments We are especially grateful to our colleagues Aneta and Marcus Rumler, Aleksandra Rysiewska, Bart³omiej Surmacz, Krzysztof Miler, Nate Gross, Mackenzie McClay, Paul Bartels, Peter Degma, Piotr G¹siorek, Witold Morek for collecting and sending samples which enable us to conduct this study. We are also grateful to Dr. Simon Carol for her invaluable help in sampling in the Republic of South Africa. Moreover, we thank to Dr. Roberto Guidetti and the Civic Museum of Natural History of Verona for making the Maucci collection available. Samples from the Republic of South Africa were collected under permits No: CN35-285316 issued by CapeNature to Witold Morek. The study was supported by the Preludium programme of the Polish National Science Centre (grant no. 2018/31/N/NZ8/03096 to DS supervised by £M). During this study, DS was a beneficiary of a National Science Centre scholarship to support doctoral research (no. 2019/32/T/NZ8/00348). Some of the analyses were carried out with the equipment purchased from the Sonata Bis programme of the Polish National Science Centre (grant no. 2016/22/E/NZ8/00417 to £M). Open-access publication of this article was funded by the BioS Priority Research Area under the program “Excellence Initiative – Research University” at the Jagiello­nian University in Krak´ow, Poland. D. Stec et al.                                                                                                                                                                                                                                     Appendix A.Supplementary data Supplementary data to this article can be found online at https://doi. org/10.1016/j.ympev.2020.106987. References Alfaro, M.E., Zoller, S., Lutzoni, F., 2003. Bayes or bootstrap? A simulation study comparing the performance of Bayesian Markov chain Monte Carlo sampling and bootstrapping in assessing phylogenetic confidence. Mol. Biol. Evol. 20 (2), 255–266. https://doi.org/10.1093/molbev/msg028. Astrin, J.J., Stüben, P.E., 2008. Phylogeny in cryptic weevils: molecules, morphology and new genera of western Palaearctic Cryptorhynchinae (Coleoptera : Curculionidae). Invertebr. Syst. 22 (5), 503–522. https://doi.org/10.1071/IS07057. Bah, T., 2011. Inkscape: guide to a vector drawing program (Vol. 559). Upper Saddle River, NJ, USA: Prentice Hall. de Barros, R., 1938. Macrobiotus evelinae nova esp´ecie dos Tardigrados. Bol. Biol. S. Paulo (N.S.) 3, 52–54. de Barros, R., 1942. Tardigrados de Estado de Sao Paulo, Brasil. II. G^enero Macrobiotus. Rev. Brasil Biol. 2, 373–386. Barto¡s, E., 1937. Die Tardigraden von Cap Caliacra (Rum¨anien) Zool. Anz. 118, 301–304. Barto¡s, E., 1939. Die Tardigraden der Tschechoslowakischen Republik. Zool. Anz. 125, 138–142. Barto¡s, E., 1963. Die Tardigraden der chinesischen und javanischen Mossproben. Vest. Csl. Spol. Zool. Acta Soc. Zool. Bohemoslov. 27, 108–114. Baumann, H., 1960. Beitrag zur Kenntnis der Tardigraden in Nord-America. Zool. Anz. 165, 123–128. Bertolani, R., Biserov, V.I., 1996. Leg and claw adaptations in soil tardigrades, with erection of two new genera of Eutardigrada, Macrobiotidae: Pseudohexapodibius and Xerobiotus. Invertebr. Biol. 115, 299–304. https://doi.org/10.2307/3227019. Bertolani, R., Biserov, V., Rebecchi, L., Cesari, M., 2011a. Taxonomy and biogeography of tardigrades using an integrated approach: new results on species of the Macrobiotus hufelandi group. Zool. Bespozvon. 8 (1), 23–36. https://doi.org/ 10.15298/invertzool.08.1.05. Bertolani, R., Rebecchi, L., Giovannini, I., Cesari, M., 2011b. DNA barcoding and integrative taxonomy of Macrobiotus hufelandi C.A.S. Schultze 1834, the first tardigrade species to be described, and some related species. Zootaxa 2997, 19–36. https://doi.org/10.11646/zootaxa.2997.1.2. Bertolani, R., Cesari, M., Giovannini, I., Rebecchi, L., Guidetti, R., Kaczmarek, £., Pilato, G., 2018. The Macrobiotus polonicus-persimilis group (Eutardigrada, Macrobiotidae), another example of problematic species identifications in tardigrades. The 14th International Symposium on Tardigrada, Copenhagen, Denmark. Bertolani, R., Cesari, M., Lisi, O., Rebecchi, L., Giovannini, I., Pilato, G., 2012. Morphology, DNA barcoding and phylogeny of Macrobiotus persimilis and Macrobiotus polonicus. The 12th International Symposium on Tardigrada, Porto, Portugal. Bertolani, R., Guidetti, R., Marchioro, T., Altiero, T., Rebecchi, L., Cesari, M., 2014. Phylogeny of Eutardigrada: New molecular data and their morphological support lead to the identification of new evolutionary lineages. Mol. Phylogenet. Evol. 76, 110–126. https://doi.org/10.1016/j.ympev.2014.03.006. Bertolani, R., Rebecchi, L., 1993. A revision of the Macrobiotus hufelandi group (Tardigrada, Macrobiotidae), with some observations on the taxonomic characters of eutardigrades. Zool. Scr. 22, 127–152. https://doi.org/10.1111/j.1463-6409.1993. tb00347.x. Bertolani, R., Rebecchi, L., Claxton, S., 1996. Phylogenetic signifiance of egg shell variation in tardigrades. Zool. J. Linn. Soc. 116, 139–148. https://doi.org/10.1111/ j.1096-3642.1996.tb02339.x. Binda, M.G., 1988. Ridescrizione di Macrobiotus echinogenitus Richters, 1904 e sul valore di buona specie di Macrobiotus crenulatus Richters, 1904 (Eutardigrada). Animalia 15 (1/3), 201–210. Binda, M.G., Pilato, G., 1992. Minibiotus furcatus, nuova posizione sistematica per Macrobiotus furcatus Ehrenberg, 1859, e descrizione di due nuove specie. Animalia 19, 111–120. Binda, M.G., Pilato, G., Moncada, E., Napolitano, A., 2001. Some tardigrades from Central Africa with the description of two new species: Macrobiotus ragonesei and M. priviterae (Eutardigrada: Macrobiotidae). Tropical Zoology 14, 233–242. https:// doi.org/10.1080/03946975.2001.10531155. Biserov, V.I., 1990a. On the revision of the genus Macrobiotus. The subgenus Macrobiotus s. str.: a new systematic status of the group hufelandi (Tardigrada, Macrobiotidae). Communication 1. Zool. Zhurnal 69, 5–17. Biserov, V.I., 1990b. On the revision of the genus Macrobiotus. The subgenus Macrobiotus s. str. a new systematic status of the hufelandi group (Tardigrada, Macrobiotidae). Communication, 2. Zool. Zhurnal 69, 38–50. Campbell, L.I., Rota-Stabelli, O., Edgecombe, G.D., Marchioro, T., Longhorn, S.J., Telford, M.J., Philippe, H., Rebecchi, L., Peterson, K.J., Pisani, D., 2011. MicroRNAs and phylogenomics resolve the relationships of Tardigrada and suggest that velvet worms are the sister group of Arthropoda. Proc. Natl. Acad. Sci. U.S.A. 108 (38), 15920–15924. https://doi.org/10.1073/pnas.1105499108. Casquet, J., Thebaud, C., Gillespie, R.G., 2012. Chelex without boiling, a rapid and easy technique to obtain stable amplifiable DNA from small amounts of ethanol-stored spiders. Mol. Ecol. Resour. 12, 136–141. https://doi.org/10.1111/j.1755- 0998.2011.03073.x. Cesari, M., Bertolani, R., Rebecchi, L., Guidetti, R., 2009. DNA barcoding in Tardigrada: the first case study on Macrobiotus macrocalix Bertolani & Rebecchi 1993 (Eutardigrada, Macrobiotidae). Mol. Ecol. Resour. 9 (3), 699–706. https://doi.org/ 10.1111/j.1755-0998.2009.02538.x. Claxton, S.K., 1998. A revision of the genus Minibiotus (Tardigrada: Macrobiotidae) with descriptions of eleven new species from Australia. Rec. Aust. Mus. 50, 125–160. https://doi.org/10.3853/j.0067-1975.50.1998.1276. Coughlan, K., Stec, D., 2019. Two new species of the Macrobiotus hufelandi complex (Tardigrada: Eutardigrada: Macrobiotidae) from Australia and India, with notes on their phylogenetic position. Eur. J. Taxon. 573, 1–38. https://doi.org/10.5852/ ejt.2019.573. Dastych, H., 1973. Redescription of Macrobiotus spectabilis Thulin 1928 (Tardigrada). Bull. Acad. Pol. Sci. Ser. Sci. Biol. 21, 823–825. Dastych, H., 1978. Parhexapodibius xerophilus sp. nov., a new species of Tardigrada from Poland. Bull. Acad. Pol. Sci. Ser. Sci. Biol. 26, 479–481. Dastych, H., 1983. Apodibius confusus gen. n. sp. n. a new Water-Bear from Poland (Tardigrada). Bull. Acad. Pol. Sci. Ser. Sci. Biol. 31, 41–46. Dastych, H., 1993. A new genus and four new species of semiterrestrial water-bears from South Africa (Tardigrada). Mitt. Hamb. Zool. Mus. Inst. 90, 175–186. Dastych, H., Alberti, G., 1990. Redescription of Macrobiotus xerophilus (Dastych, 1978) comb. nov., with some phylogenetic notes (Tardigrada, Macrobiotidae). Mitt. Hamb. Zool. Mus. Inst. 87, 157–169. Degma, P., Bertolani, R., Guidetti, R., 2009–2020. Actual checklist of Tardigrada species. https://doi.org/10.25431/11380_1178608. Degma, P., Guidetti, R., 2007. Notes to the current checklist of Tardigrada. Zootaxa, 1579, 41–53. https://doi.org/10.11646/zootaxa.1579.1.2. Doy`ere, P.L.N., 1840. Memoire sur les Tardigrades. Ann. Sci. Nat. Zool. 14, 269–362. Edgar, R.C., 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32 (5), 1792–1797. https://doi.org/10.1093/nar/ gkh340. Ehrenberg, C.G., 1859. Beitrag zur Bestimmung des station¨aren mikroscopischen Lebens in bis 20,000 Fuss Alpenh¨ohe. Abhand. K. Akad. Wiss. Berlin 429–456. Folmer, O., Black, M., Hoeh, W., Lutz, R., Vrijenhoek, R., 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 3, 294–299. Fontoura, P., 1981. Contribution pour l’etude des Tardigrades terrestres du Portugal. Avec la description d’une nouvelle esp`ece du genre Macrobiotus. Publicacoes do Instituto de Zoologia “Dr. Augusto Nobre“, Faculdade Ciencas do Porto LXII, 157–178. Fontoura, P., Pilato, G., Morais, P., Lisi, O., 2009. Minibiotus xavieri, a new species of tardigrade from the Parque Biol´ogico de Gaia, Portugal (Eutardigrada: Macrobiotidae). Zootaxa, 2267, 55–64. https://doi.org/10.11646/zootaxa.2267.1.4. G¹siorek, P., Stec, D., Morek, W., Michalczyk, £., 2019. Deceptive conservatism of claws: distinct phyletic lineages concealed within Isohypsibioidea (Eutardigrada) revealed by molecular and morphological evidence. Contrib. to Zool. 88 (1), 78–132. https:// doi.org/10.1163/18759866-20191350. G¹siorek, P., Stec, D., Zawierucha, Z., Kristensen, R.M., Michalczyk, £., 2018. Revision of Testechiniscus Kristensen, 1987 (Heterotardigrada: Echiniscidae) refutes the polar- temperate distribution of the genus. Zootaxa, 4472, 2, 261–297. https://doi.org/10. 11646/zootaxa.4472.2.3. G¹siorek, P., Von¡cina, K., Degma, P., Michalczyk, £., 2020. Small is beautiful: the first phylogenetic analysis of Bryodelphax Thulin, 1928 (Heterotardigrada: Echiniscidae). Zoosyst. Evol. 96 (1). Grobys, D., Roszkowska, M., Gawlak, M., Kmita, H., Kepel, A., Kepel, M., Parnikoza, I., Bartylak, T., Kaczmarek, £., 2020. High diversity in the Pseudechiniscus suillus- facettalis complex (Heterotardigrada; Echiniscidae) with remarks on the morphology of the genus Pseudechiniscus. Zool. J. Linn. Soc. 188 (3), 733–752. https://doi.org/ 10.1093/zoolinnean/zlz171. Guidetti, R., 1998. Two new species of Macrobiotidae (Tardigrada: Eutardigrada) from the United States of America, and some taxonomic considerations of the genus Murrayon. Proc. Biol. Soc. Wash. 111, 663–673. Guidetti, R., Bertolani, R., 2005. Tardigrade taxonomy: an updated check list of the taxa and a list of characters for their identification. Zootaxa, 845, 1–46. https://doi.org/1 0.11646/zootaxa.845.1.1. Guidetti, R., Cesari, M., Bertolani, R., Altiero, T., Rebecchi, L., 2019. High diversity in species, reproductive modes and distribution within the Paramacrobiotus richtersi complex (Eutardigrada, Macrobiotidae). Zool. Lett. 5, 1. https://doi.org/10.1186/ s40851-018-0113-z. Guidetti, R., Gandolfi, A., Rossi, V., Bertolani, R., 2005. Phylogenetic analysis of Macrobiotidae (Eutardigrada, Parachela): a combined morphological and molecular approach. Zool. Scr. 34, 235–244. https://doi.org/10.1111/j.1463- 6409.2005.00193.x. Guidetti, R., Peluffo, J.R., Rocha, A.M., Cesari, M., Moly de Peluffo, M.C., 2013. The morphological and molecular analyses of a new South American urban tardigrade offer new insights on the biological meaning of the Macrobiotus hufelandi group of species (Tardigrada: Macrobiotidae). J. Nat. Hist. 47 (37–38), 2409–2426. https:// doi.org/10.1080/00222933.2013.800610. Guidetti, R., Pilato, G., 2003. Revision of the genus Pseudodiphascon (Tardigrada, Macrobiotidae), with the erection of three new genera. J. Nat. Hist. 37 (14), 1679–1690. https://doi.org/10.1080/00222930210126659. Guidetti, R., Rebecchi, L., Bertolani, R., 2000. Cuticule structure and systematics of Macrobiotidae (Tardigrada: Eutardigrada). Acta Zool. 81, 27–36. https://doi.org/ 10.1046/j.1463-6395.2000.00034.x. Guidetti, R., Rebecchi, L., Bertolani, R., J¨onsson, K.I., Kristensen, R.M., Cesari, M., 2016. Morphological and molecular analyses on Richtersius (Eutardigrada) diversity reveal its new systematic position and lead to the establishment of a new genus and a new family within Macrobiotoidea. Zool. J. Linn. Soc. 178 (4), 834–845. https://doi.org/ 10.1111/zoj.12428. D. Stec et al.                                                                                                                                                                                                                                     Guidetti, R., Schill, R.O., Bertolani, R., Dandekar, T., Wolf, M., 2009. New molecular data for tardigrade phylogeny, with the erection of Paramacrobiotus gen. nov. J. Zoolog. Syst. Evol. Res. 47 (4), 315–321. https://doi.org/10.1111/j.1439-0469.2009.00526. x. Guidi, A., Rebecchi, L., 1996. Spermatozoon morphology as a character for tardigrade systematics: Comparison with sclerified parts of animals and eggs in eutardigrades. Zool. J. Linn. Soc. 116, 101–113. https://doi.org/10.1111/j.1096-3642.1996. tb02336.x. Guil, N., Giribet, G., 2012. A comprehensive molecular phylogeny of tardigrades - adding genes and taxa to a poorly resolved phylum-level phylogeny. Cladistics 28 (1), 21–49. https://doi.org/10.1111/j.1096-0031.2011.00364.x. Guil, N., Jorgensen, A., Kristensen, R.M., 2019. An upgraded comprehensive multilocus phylogeny of the Tardigrada tree of life. Zool. Scr. 48 (1), 120–137. https://doi.org/ 10.1111/zsc.12321. Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95–98. Heinis, F., 1920. Systematik und Biologie der moosbewohnenden Rhizopoden, Tardigrade und Rotatorien der Ugebung von Basel. Arch. Hydrobiol., 5. Hohberg, K., Russell, D.J., Elmer, M., 2011. Mass occurrence of algal-feeding tardigrade Apodibius confusus, in the young soils of a post-mining site. J. Zoolog. Syst. Evol. Res. 49, 62–65. https://doi.org/10.1111/j.1439-0469.2010.00600.x. Iharos, A., 1940. Adatok Magyarosz´ag Tardigrada Faun´ajahoz. A Keszthelyi Prem. Gimn. ´Evk¨onyve, Keszthely, 15–32. Iharos, G., 1963. The zoological results of Gy. Topal’s collections in South Argentina, 3. Tardigrada. Ann. Hist. Natur. Ms. Nat. Hung Budapest 55, 293–299. Iharos, G., 1966a. Neue Tardigraden-arten aus Ungarn. Acta Zool. Acad. Sci. Hung. 12, 111–122. Iharos, G., 1966b. Beitr¨age zur Kenntnis der Tardigraden-Fauna ¨Osterreichs. Acta Zool. Acad. Sci. Hung. 12, 123–127. Iharos, G., 1969. Tardigraden aus Mittelwestafrika. Opusc. Zool. (Budap.) 9, 115–120. Kaczmarek, £., Bartylak, T., Stec, D., Kulpa, A., Kepel, M., Kepel, A., Roszkowska, M., 2020. Revisiting the genus Mesobiotus Vecchi et al., 2016 (Eutardigrada, Macrobiotidae) – remarks, updated dichotomous key and an integrative description of new species from Madagascar. Zoologischer Anzeiger, 287, 121–146. https://doi. org/10.1016/j.jcz.2020.05.003. Kaczmarek, £., Cytan, J., Zawierucha, K., Diduszko, D., Michalczyk, £., 2014. Tardigrades from Peru (South America), with descriptions of three new species of Parachela. Zootaxa, 3790, 2, 357–379. https://doi.org/10.11646/zootaxa.3790.2.5. Kaczmarek, £., Gawlak, M., Bartels, P.J., Neslon, D.R., Roszkowska, M., 2017. Revision of the genus Paramacrobiotus Guidetti et al., 2009 with the description of a new species, re-descriptions and a key. Annal. Zool., 67, 4, 627–656. https://doi.org/10. 3161/00034541ANZ2017.67.4.001. Kaczmarek, £., Michalczyk, £., 2006. Redescription of Macrobiotus tridigitus Schuster, 1983 and erection of a new genus of Tardigrada (Eutardigrada, Macrobiotidae). J. Nat. Hist. 40 (19–20), 1223–1229. https://doi.org/10.1080/ 00222930600844443. Kaczmarek, £., Michalczyk, £., 2009. Two new species of Macrobiotidae, Macrobiotus szeptyckii (harmsworthi group) and Macrobiotus kazmierskii (hufelandi group) from Argentina. Acta Zool. Cracov., Seria B - Invertebrata 52 (1–2), 87–99. https://doi. org/10.3409/azc.52b_1-2.87-99. Kaczmarek, £., Michalczyk, £., 2017. The Macrobiotus hufelandi (Tardigrada) group revisited. Zootaxa, 4363, 1, 101–123. https://doi.org/10.11646/zootaxa.4363.1.4. Kaczmarek, £., Zawierucha, K., Buda, J., Stec, D., Gawlak, M., Michalczyk, £., Roszkowska, M., 2018. An integrative redescription of the nominal taxon for the Mesobiotus harmsworthi group (Tardigrada: Macrobiotidae) leads to descriptions of two new Mesobiotus species from Arctic. PLoS ONE 13 (10), e0204756. https://doi. org/10.1371/journal.pone.0204756. Kathman, R.D., 1990. Some tardigrades from Colorado, with description of a new species of Macrobiotus (Macrobiotidae: Eutardigrada). Proc. Biol. Soc. Wash. 103 (2), 300–303. Katoh, K., Misawa, K., Kuma, K., Miyata, T., 2002. MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res. 30, 3059–3066. https://doi.org/10.1093/nar/gkf436. Katoh, K., Toh, H., 2008. Recent developments in the MAFFT multiple sequence alignment program. Brief. Bioinformatics 9, 286–298. https://doi.org/10.1093/bib/ bbn013. Kayastha, P., Berdi, D., Mioduchowska, M., Gawlak, M., £ukasiewicz, A., Go³dyn, B., Kaczmarek, £., 2020. Some tardigrades from Nepal (Asia) with integrative description of Macrobiotus wandae sp. nov (Macrobiotidae: hufelandi group). Annal. Zool. 70 (1), 121–142. https://doi.org/10.3161/00034541ANZ2020.70.1.007. Kumar, S., Stecher, G., Tamura, K., 2016. MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 33, 1870–1874. https://doi. org/10.1093/molbev/msw054. Lanfear, R., Frandsen, P.B., Wright, A.M., Senfeld, T., Calcott, B., 2016. PartitionFinder 2: new methods for selecting partitioned models of evolution formolecular and morphological phylogenetic analyses. Mol. Biol. Evol. 34 (3), 772–773. https://doi. org/10.1093/molbev/msw260. Lisi, O., Londo~no, R., Quiroga, S., 2020. Description of a new genus and species (Eutardigrada: Richtersiidae) from Colombia, with comments on the family Richtersiidae. Zootaxa, 4822, 4, 531–550. https://doi.org/10.11646/zootaxa.4822. 4.4. Londo~no, R., Daza, A., Lisi, O., Quiroga, S., 2017. New species of waterbear Minibiotus pentannulatus (Tardigrada: Macrobiotidae) from Colombia. Rev. Mex. Biodivers. 88 (4), 807–814. https://doi.org/10.1016/j.rmb.2017.10.040. Marley, N.J., Kaczmarek, £., Gawlak, M. Bartels, P.J., Nelson, D.R., Roszkowska, M., Stec, D., Degma, P., 2018. A clarification for the subgenera of Paramacrobiotus Guidetti, Schill, Bertolani, Dandekar and Wolf, 2009, with respect to the International Code of Zoological Nomenclature. Zootaxa, 4407, 1, 130–134. htt ps://doi.org/10.11646/zootaxa.4407.1.9. Marley, N.J., McInnes, S.J., Sands, C.J., 2011. Phylum Tardigrada: A re-evaluation of the Parachela. Zootaxa, 2819, 51–64. https://doi.org/10.11646/zootaxa.2819.1.2. Maucci, W., 1954. Tardigradi nuovi della fauna Italiana. Atti Soc. Ital. Sci. Nat., Milano, 93: 576–585. Maucci, W., 1983. Sulla presenza in Italia di Cornechiniscus holmeni (Petersen, 1951), e descrizione di Macrobiotus hyperonyx sp. nov. Boll. Mus. Civ. St. Nat. Verona 9, 175–179. Maucci, W., 1986. Tardigrada. Fauna d‘Italia. Bologna, Calderini 24, 1–388. Maucci, W., 1988. Tardigrada from Patagonia (Southern South America) with description of three new species. Rev. Chilena Entomol. 16, 5–13. Maucci, W., Pilato, G., 1974. Macrobiotus spectabilis Thulin, 1928 e Macrobiotus grandis Richters, 1911: due buone species di Eutardigradi. Animalia 1, 245–255. May, R.M., 1948. Nouveau genre et esp`ece de Tardigrade du Mexique: Haplomacrobiotus hermosillensis. Bull. Soc. Zool. Fr. 73, 95–97. Meyer, H.A., 2011. Tardigrada of Grand Cayman, West Indies, with descriptions of two new species of eutardigrade, Doryphoribius tessellatus (Hypsibiidae) and Macrobiotus caymanensis (Macrobiotidae). Zootaxa, 2812, 28–40. https://doi.org/10.11646 /zootaxa.2812.1.3. Michalczyk, £., Kaczmarek, £., 2003. A description of the new tardigrade Macrobiotus reinhardti (Eutardigrada, Macrobiotidae, harmsworthi group) with some remarks on the oral cavity armature within the genus Macrobiotus Schultze. Zootaxa, 331, 1–24. https://doi.org/10.11646/zootaxa.331.1.1. Michalczyk, £., Kaczmarek, £., 2004. Minibiotus eichhorni, a new species of Tardigrada (Eutardigrada, Macrobiotidae) from Peru. Annal. Zool. 54 (4), 673–676. Michalczyk, £., Kaczmarek, £., 2013. The Tardigrada Register: a comprehensive online data repository for tardigrade taxonomy. J. Limnol. 72, 175–181. https://doi.org/ 10.4081/jlimnol.2013.s1.e22. Mihel¡ci¡c, F., 1949. Nuevos biotopos de Tardigrados. An. de Edafologia y Fisiologia vegetal 8, 511–520. Mihel¡ci¡c, F., 1951. Beitrag zur Systematik der Tardigraden. Archivio Zool. Italiano 36, 57–103. Mihel¡ci¡c, F., 1971/1972. Ein Beitrag zur Kenntnis der Süsswassertardigraden Nordeuropas. Verh. zool. bot. Ges. Wien, 110/111, 37–45. Miller, M.A., Pfeiffer, W., Schwartz, T., 2010. Creating the CIPRES Science Gateway for inference of large phylogenetic trees. In 2010 gateway computing environments workshop (GCE) (pp. 1–8). https://doi.org/10.1109/GCE.2010.5676129. Mironov, S.V., Dabert, J., Dabert, M., 2012. A new feather mite species of the genus Proctophyllodes Robin, 1877 (Astigmata: Proctophyllodidae) from the Long-tailed Tit Aegithalos caudatus (Passeriformes: Aegithalidae): morphological description with DNA barcode data. Zootaxa, 3253, 54–61. https://doi.org/10.11646/zootaxa.3253. 1.2. Morek, W., Ciosek, J., Michalczyk, £., 2020. Description of Milnesium pentapapillatum sp. nov., with an amendment of the diagnosis of the order Apochela and abolition of the class Apotardigrada (Tardigrada). Zool. Anz. 288, 107–117. https://doi.org/ 10.1016/j.jcz.2020.07.002. Morek, W., Michalczyk, £., 2020. First extensive multilocus phylogeny of the genus Milnesium Doy`ere, 1840 (Tardigrada) reveals no congruence between genetic markers and morphological traits. Zool. J. Linn. Soc. 188 (3), 681–693. https://doi. org/10.1093/zoolinnean/zlz040. Morek, W., Stec, D., G¹siorek, P., Schill, R.O., Kaczmarek, £., Michalczyk, £., 2016. An experimental test of eutardigrade preparation methods for light microscopy. Zool. J. Linn. Soc. 178 (4), 785–793. https://doi.org/10.1111/zoj.12457. Morek, W., Stec, D., G¹siorek, P., Surmacz, B., Michalczyk, £., 2019. Milnesium tardigradum Doy`ere, 1840: the first integrative study of inter-population variability in a tardigrade species. J. Zool. Syst. Evol. Res 57 (1), 1–23. https://doi.org/ 10.1111/jzs.12233. Murray, J., 1907. Some Tardigrada of the Sikkim Himalaya. J. Roy. Microsc. Soc. 1907, 269–273. Murray, J., 1910. Tardigrada. British Antarctic Expedition 1907-1909. Reports on the Scientific Investigations. Vol. 1 Biology (Part V), 83–187. https://doi.org/10.1111 /j.1365-2818.1907.tb01654.x. Nelson, D.R., Guidetti, R., Rebecchi, L., 2015. Phylum Tardigrada. In: Ecology and General Biology: Vol. 1: Thorp and Covich’s Freshwater Invertebrates (4th Edition), 347–380. https://doi.org/10.1016/B978-0-12-385026-3.00017-6. Pilato, G. & Binda, M.G., 2010. Definition of families, subfamilies, genera and subgenera of the Eutardigrada, and keys to their identification. Zootaxa, 2404, 1–52. htt ps://doi.org/10.11646/zootaxa.2404.1.1. Pilato, G., 1969a. Schema per una nuova sistemazione delle famiglie e dei genri degli Eutardigrada. Boll. Sed. Accad. Gioen. Sci. Nat. Catania 10, 181–193. Pilato, G., 1969b. Su un interessante Tardigrado esapodo delle dune costiere siciliane: Hexapodibius micronyx n. gen. n. sp. Boll. Accad. Gioenia Sci. nat Catania 9, 619–622. Pilato, G., 1972. Prime osservazioni sui Tardigradi delle Isole Egadi. Boll. sed. Acc. Gioenia Sci. Nat. Catania, Ser IV 11 (5), 111–124. Pilato, G., 1977. Macrobiotus willardi a new species of Tardigrada from Canada. Can. J. Zool. 55, 628–630. https://doi.org/10.1139/z77-080. Pilato, G., 1981. Analisi di nuovi caratteri nello studio degli Eutardigradi. Animalia 8, 51–57. Pilato, G., 1982. The systematics of Eutardigrada. A comment. Z. f. zool. Syst und Evolutionsforsch. 20, 271–284. https://doi.org/10.1111/j.1439-0469.1983. tb00553.x. Pilato, G., 2006. Remarks on the Macrobiotus polyopus group, with the description of two new species (Eutardigrada, Macrobiotidae). Zootaxa, 1298, 37–47. https://doi. org/10.11646/zootaxa.1298.1.4. D. Stec et al.                                                                                                                                                                                                                                     Pilato, G., Beasley, C.W., 1987. Haplohexapodibius seductor n. gen. n. sp. (Eutardigrada Calohypsibiidae) with remarks on the systematic position of the new genus. Animalia 14, 65–71. Pilato, G., Binda, M.G., Lisi, O., 2004. Famelobiotus salici, n. gen. n. sp., a new eutardigrade from Borneo. N.Z. J. Zool. 31, 57–60. https://doi.org/10.1080/ 03014223.2004.9518359. Pilato, G., Kaczmarek, £., Michalczyk, £., Lisi, O., 2003. Macrobiotus polonicus, a new species of Tardigrada from Poland (Eutardigrada, Macrobiotidae, ’hufelandi group’). Zootaxa, 258, 1–8. https://doi.org/10.11646/zootaxa.258.1.1. Pilato, G., Kiosya, Y., Lisi, O., Inshina, V., Biserov, V., 2011. Annotated list of Tardigrada records from Ukraine with the description of three new species. Zootaxa, 3123, 1–31. https://doi.org/10.11646/zootaxa.3123.1.1. Pilato, G., Lisi, O., 2010. Tenuibiotus, a new genus of Macrobiotidae (Eutardigrada). Zootaxa, 2761, 34–40. https://doi.org/10.11646/zootaxa.2761.1.2. Prendini, L., Weygoldt, P., Wheeler, W.C., 2005. Systematics of the Damon variegatus group of African whip spiders (Chelicerata: Amblypygi): evidence from behaviour, morphology and DNA. Org. Divers. Evol. 5, 203–236. https://doi.org/10.1016/j. ode.2004.12.004. Rahm, G., 1931. Tardigrada of the South of America. Revista Chilena de Historia Natural 35, 118–141. Ramazzotti, G., 1957. Due Nuove specie di Tardigradi extra-europei. Atti Soc. Ital. Sci. Nat. 96, 188–191. Ramazzotti, G., 1965. Il phylum Tardigrada (1. supplemento). Mem Ist. Ital. Idrobiol. 19, 101–212. Ramazzotti, G., Maucci, W., 1983. Il Phylum Tardigrada. Mem. Ist. Ital. Idrobiol. 41, 1–1012. Rambaut, A., 2007. FigTree, a graphical viewer of phylogenetic trees. Rambaut, A., Drummond, A.J., Xie, D., Baele, G., Suchard, M.A., 2018. Posterior summarization in Bayesian phylogenetics using Tracer 1.7. Syst. Biol. 67 (5), 901–904. https://doi.org/10.1093/sysbio/syy032. Rebecchi, L., Altiero, T., Guidi, A., 2011. The ultrastructure of the tardigrade spermatozoon: a comparison between Paramacrobiotus and Macrobiotus species (Eutardigrada). Zool. Bespozvon., 8, 1, 63–67. https://doi.org/10.15298/invertzoo l.08.1.08. Rebecchi, L., Guidi, A., Bertolani, R., 2000. Maturative pattern of ovotestis in two hermaphroditic species of tardigrades. Invertebr. Reprod. Dev. 37, 25–34. https:// doi.org/10.1080/07924259.2000.9652397. Richters, F., 1904. Arktische Tardigraden. Fauna Arctica 3, 494–508. Richters, F., 1908. Moosfauna-Studien. Ber. Senckenbergischen Naturforsch. Gesellschaft Frankfurt 14. Richters, F., 1926. Tardigrada. In: Kükenthal, W. & Krumbach, T. (Eds.), Handbuch der Zoologie. Vol. 3. Walter de Gruyter & Co., Berlin & Leipzig, pp. 58–61. Ronquist, F., Teslenko, M., Van Der Mark, P., Ayres, D.L., Darling, A., H¨ohna, S., Huelsenbeck, J.P., 2012. MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 61 (3), 539–542. https://doi. org/10.1093/sysbio/sys029. Sands, C.J., McInnes, S.J., Marley, N.J., Goodall-Copestake, W., Convey, P., Linse, K., 2008. Phylum Tardigarda: an “individual” approach. Cladistics 24, 1–18. https:// doi.org/10.1111/j.1096-0031.2008.00219.x. Schultze, C.A.S., 1834. Macrobiotus Hufelandii animal e crustaceorum classe novum, reviviscendi post diuturnam asphixiam et aridiatem potens, etc. 8, 1 tab. C. Curths, Berlin, 6 pp, I Table. Schuster, R.O., Nelson, D.R., Grigarick, A.A., Christenberry, D., 1980. Systematic criteria of the Eutardigrada. Trans. Am. Microsc. Soc. 99, 284–303. https://doi.org/ 10.2307/3226004. Schwendinger, P.J., Giribet, G., 2005. The systematics of the south-east Asian genus Fangensis Rambla (Opiliones: Cyphophthalmi: Stylocellidae). Invertebr. Syst. 19, 297–323. https://doi.org/10.1071/IS05023. Stamatakis, A., 2014. RAxML Version 8: A tool for Phylogenetic Analysis and Post- Analysis of Large Phylogenies. Bioinformatics 30 (9), 1312–1313. https://doi.org/ 10.1093/bioinformatics/btu033. Stec, D., Arakawa, K., Michalczyk, £., 2018a. An integrative description of Macrobiotus shonaicus sp. nov. (Tardigrada: Macrobiotidae) from Japan with notes on its phylogenetic position within the hufelandi group. PLoS ONE 13 (2), e0192210. https://doi.org/10.1371/journal.pone.0192210. Stec, D., G¹siorek, P., Morek, W., Koszty³a, P., Zawierucha, K., Michno, K., Kaczmarek, £., Prokop, Z.M., Michalczyk, £., 2016. Estimating optimal sample size for tardigrade morphometry. Zool. J. Linn. Soc. 178 (4), 776–784. https://doi.org/ 10.1111/zoj.12404. Stec, D., Kristensen, R.M., Michalczyk, £., 2020a. An integrative description of Minibiotus ioculator sp. nov. from the Republic of South Africa with notes on Minibiotus pentannulatus Londo~no et al., 2017 (Tardigrada: Macrobiotidae). Zool. Anz., 286, 117–134. https://doi.org/10.1016/j.jcz.2020.03.007. Stec, D., Kristensen, R.M.. Michalczyk, £., 2018b. Integrative taxonomy identifies Macrobiotus papei, a new tardigrade species of the Macrobiotus hufelandi complex (Eutardigrada: Macrobiotidae) from the Udzungwa Mountains National Park (Tanzania). Zootaxa, 4446, 2, 273–291. https://doi.org/10.11646/zootaxa.4446.2. 7. Stec, D., Krzywa´nski, £., Michalczyk, £., 2018c. Integrative description of Macrobiotus canaricus sp. nov. with notes on M. recens (Eutardigrada: Macrobiotidae). Eur. J. Taxon. 452, 1–36. https://doi.org/10.5852/ejt.2018.452. Stec, D., Krzywa´nski, £., Zawierucha, K., Michalczyk, £., 2020b. Untangling systematics of the Paramacrobiotus areolatus species complex by an integrative redescription of the nominal species for the group, with multilocus phylogeny and species delineation within the genus Paramacrobiotus. Zool. J. Linn. Soc. 188 (3), 694–716. https://doi.org/10.1093/zoolinnean/zlz163. Stec, D., Morek, W., G¹siorek, P., Blagden, B., Michalczyk, £., 2017a. Description of Macrobiotus scoticus sp. nov. (Tardigrada: Macrobiotidae: hufelandi group) from Scotland by means of integrative taxonomy. Annal. Zool. 67 (2), 181–197. https:// doi.org/10.3161/00034541ANZ2017.67.2.001. Stec, D., Morek, W., G¹siorek, P., Michalczyk, £., 2018d. Unmasking hidden species diversity within the Ramazzottius oberhaeuseri complex, with an integrative redescription of the nominal species for the family Ramazzottiidae (Tardigrada: Eutardigrada: Parachela). System. Biodivers. 16 (4), 357–376. https://doi.org/ 10.1080/14772000.2018.1424267. Stec, D., Smolak, R., Kaczmarek, £., Michalczyk, £., 2015. An integrative description of Macrobiotus paulinae sp. nov. (Tardigrada: Eutardigrada: Macrobiotidae: hufelandi group) from Kenya. Zootaxa, 4052, 5, 501–526. https://doi.org/10.11646/zootaxa. 4052.5.1. Stec. D., Zawierucha, K., Michalczyk, £., 2017b. An integrative description of Ramazzottius subanomalus (Biserov, 1985) (Tardigrada) from Poland. Zootaxa, 4300, 3, 403–420. https://doi.org/10.11646/zootaxa.4300.3.4. Thulin, G., 1928. Über die Phylogenie und das System der Tardigraden. Hereditas 11, 207–266. https://doi.org/10.1111/j.1601-5223.1928.tb02488.x. Tumanov, D.V., 2005. Two new species of Macrobiotus (Eutardigrada, Macrobiotidae) from Tien Shan (Kirghizia), with notes on Macrobiotus tenuis group. Zootaxa 1043 (1), 33–46. https://doi.org/10.11646/zootaxa.1043.1.3. Tumanov, D.V., 2007. Three new species of Macrobiotus (Eutardigrada, Macrobiotidae, tenuis-group) from Tien Shan (Kirghizia) and Spitsbergen. J. Limnol. 66, 40–48. https://doi.org/10.4081/jlimnol.2007.s1.40. Vecchi, M., Cesari, M., Bertolani, R., J¨onsson, K.I., Rebecchi, L., Guidetti, R., 2016. Integrative systematic studies on tardigrades from Antarctica identify new genera and new species within Macrobiotoidea and Echiniscoidea. Invertebr. Syst. 30 (4), 303–322. https://doi.org/10.1071/IS15033. Warren, D.L., Geneva, A.J., Lanfear, R., 2017. RWTY (R We There Yet): an R package for examining convergence of Bayesian phylogenetic analyses. Mol. Biol. Evol. 34 (4), 1016–1020. https://doi.org/10.1093/molbev/msw279. Wêglarska, B., 1968. Bodentardigraden des Hohen Hindukusch (Tardigrada). Acta Zoologica Cracoviensia 13, 441–446. Wheeler, D.L., Barrett, T., Benson, D.A., Bryant, S.H., Canese, K., Chetvernin, V., Geer, L. Y., 2006. Database resources of the national center for biotechnology information. Nucleic Acids Res. 35, D5–D12. https://doi.org/10.1093/nar/gkj158. Whiting, M.F., Carpenter, J.C., Wheeler, Q.D., Wheeler, W.C., 1997. The Strepsiptera problem: phylogeny of the holometabolous insect orders inferred from 18S and 28S ribosomal DNA sequences and morphology. Syst. Biol. 46 (1), 1–68. https://doi.org/ 10.1093/sysbio/46.1.1. Yang, T., 1999. Three new species and six new records of the class Eutardigrada (Tardigrada) from China (Parachela: Macrobiotidae: Hypsibiidae). Acta Zootax. Sin. 24, 444–453. Yang, T., 2002. The tardigrades from some mosses of Lijiang County in Yunnan province (Heterotardigrada: Echiniscidae: Eutardigrada: Parachela: Macrobiotidae, Hypsibiidae). Acta Zootax. Sin. 27, 53–64. Zawierucha, K., Kolicka, M., Kaczmarek, £., 2016. Re-description of the Arctic tardigrade Tenuibiotus voronkovi (Tumanov, 2007) (Eutardigrada; Macrobiotidae), with the first molecular data for the genus. Zootaxa, 4196, 4, 498–510. https://doi.org/10.11646 /zootaxa.4196.4.2. Zhang, P., Sun, X.-Z., 2014. A new species of the genus Macrobiotus (Tardigrada: Macrobiotidae) from Southeastern China. Zool. Syst. 39 (2), 224–228. D. Stec et al.